CRISPR

CRISPR1-npy

ID

ZDB-CRISPR-201118-2

Name

CRISPR1-npy

Previous Names

None

Target

npy (1)

Sequence

5' - TTCTCTTGTTCGTCTGCTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
kgs1	npy
kgs2	npy

Expression

Gene expression in Wild Types + CRISPR1-npy

No data available

Phenotype

Phenotype resulting from CRISPR1-npy

No data available

Phenotype of all Fish created by or utilizing CRISPR1-npy

Phenotype	Fish	Conditions	Figures
brain hcrt expression increased amount, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 8 from Shiozaki et al., 2020
brain th expression increased amount, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 8 from Shiozaki et al., 2020
brain th2 expression increased amount, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 8 from Shiozaki et al., 2020
brain nr3c1 expression increased amount, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 8 from Shiozaki et al., 2020
brain cckb expression increased amount, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 8 from Shiozaki et al., 2020
swimming behavior decreased linear velocity, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 5 from Shiozaki et al., 2020
behavioral fear response increased occurrence, abnormal	npy^kgs1/kgs1	standard conditions	Fig. 4 from Shiozaki et al., 2020
brain nr3c2 expression increased amount, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 8 from Shiozaki et al., 2020
swimming behavior process quality, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 5 from Shiozaki et al., 2020
behavioral fear response increased occurrence, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 5 from Shiozaki et al., 2020
aggressive behavior decreased occurrence, abnormal	npy^kgs1/kgs1	standard conditions	Fig. 4 from Shiozaki et al., 2020
brain pomca expression increased amount, abnormal	npy^kgs1/kgs1	standard conditions	Fig. 7 from Shiozaki et al., 2020
brain avp expression increased amount, abnormal	npy^kgs1/kgs1	standard conditions	Fig. 7 from Shiozaki et al., 2020
aggressive behavior decreased occurrence, abnormal	npy^kgs1/kgs1	temperature shock	Fig. 5 from Shiozaki et al., 2020
brain th expression increased amount, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 8 from Shiozaki et al., 2020
brain hcrt expression increased amount, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 8 from Shiozaki et al., 2020
brain th2 expression increased amount, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 8 from Shiozaki et al., 2020
behavioral fear response increased occurrence, abnormal	npy^kgs2/kgs2	standard conditions	Fig. 4 from Shiozaki et al., 2020
swimming behavior decreased linear velocity, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 5 from Shiozaki et al., 2020
brain cckb expression increased amount, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 8 from Shiozaki et al., 2020
brain nr3c2 expression increased amount, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 8 from Shiozaki et al., 2020
swimming behavior process quality, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 5 from Shiozaki et al., 2020
behavioral fear response increased occurrence, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 5 from Shiozaki et al., 2020
brain nr3c1 expression increased amount, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 8 from Shiozaki et al., 2020
aggressive behavior decreased occurrence, abnormal	npy^kgs2/kgs2	standard conditions	Fig. 4 from Shiozaki et al., 2020
brain pomca expression increased amount, abnormal	npy^kgs2/kgs2	standard conditions	Fig. 7 from Shiozaki et al., 2020
aggressive behavior decreased occurrence, abnormal	npy^kgs2/kgs2	temperature shock	Fig. 5 from Shiozaki et al., 2020
brain avp expression increased amount, abnormal	npy^kgs2/kgs2	standard conditions	Fig. 7 from Shiozaki et al., 2020

Citations