CRISPR

CRISPR1-pax1a

ID
ZDB-CRISPR-201110-1
Name
CRISPR1-pax1a
Previous Names
None
Target
Sequence
5' - GGGGAGGTGAACCAGCTGGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
as36 pax1a
gnu25 pax1a
Expression
Gene expression in Wild Types + CRISPR1-pax1a
No data available
Phenotype
Phenotype resulting from CRISPR1-pax1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pax1a
Phenotype Fish Conditions Figures
ceratobranchial cartilage absent, abnormal pax1aas36/+ + MO3-pax1b standard conditions Fig. 5 with image from Liu et al., 2020
pharyngeal pouch 3 tbx1 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 4 alcama expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal arch 3 dlx2a expression decreased amount, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 5 edn1 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
ceratobranchial 2 cartilage absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 5 with image from Liu et al., 2020
pharyngeal arch 3 hand2 expression decreased amount, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 2 morphology, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
ceratobranchial 4 cartilage absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 5 with image from Liu et al., 2020
pharyngeal arch 4 dlx2a expression decreased amount, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 6 with image from Liu et al., 2020
basibranchial 3 absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 5 with image from Liu et al., 2020
basibranchial 4 absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 5 with image from Liu et al., 2020
pharyngeal pouch 2 nkx2.3 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
ceratobranchial 3 cartilage absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 5 with image from Liu et al., 2020
basibranchial 2 absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 5 with image from Liu et al., 2020
pharyngeal pouch 4 tbx1 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal arch 4 hand2 expression decreased amount, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 3 alcama expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 5 nkx2.3 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 3 morphology, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 5 morphology, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 1 fgf3 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 4 morphology, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 5 tbx1 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 3 edn1 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal arch 6 dlx2a expression decreased amount, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 5 fgf3 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 2 alcama expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal arch 5 hand2 expression decreased amount, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 4 nkx2.3 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 2 fgf3 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 2 edn1 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 5 alcama expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
ceratobranchial 5 cartilage decreased length, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 5 with image from Liu et al., 2020
pharyngeal pouch 4 fgf3 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal arch 6 hand2 expression decreased amount, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 4 edn1 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
ceratobranchial 1 cartilage absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 5 with image from Liu et al., 2020
pharyngeal arch 5 dlx2a expression decreased amount, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 6 with image from Liu et al., 2020
pharyngeal pouch 1 alcama expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 3 fgf3 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
pharyngeal pouch 3 nkx2.3 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 9 with image from Liu et al., 2020
pharyngeal pouch 2 tbx1 expression absent, abnormal pax1aas36/as36; pax1bas37/as37 standard conditions Fig. 10 with image from Liu et al., 2020
Citations