CRISPR

CRISPR1-rps9

ID

ZDB-CRISPR-200528-2

Name

CRISPR1-rps9

Previous Names

None

Target

rps9 (1)

Sequence

5' - GCGTATTGGAGTGCTGGATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
la489	rps9
la490	rps9
la491	rps9

Expression

Gene expression in Wild Types + CRISPR1-rps9

No data available

Phenotype

Phenotype resulting from CRISPR1-rps9

No data available

Phenotype of all Fish created by or utilizing CRISPR1-rps9

Phenotype	Fish	Conditions	Figures
head cdkn1a expression increased amount, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 5 from Chen et al., 2019
trunk hemoglobin decreased amount, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 3 from Chen et al., 2019
eye decreased size, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 1 from Chen et al., 2019
pericardium edematous, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 1 , Figure 5 from Chen et al., 2019
whole organism rps9 expression decreased amount, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 2 from Chen et al., 2019
trunk shortened, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 1 , Figure 2 , Figure 5 from Chen et al., 2019
pharyngeal arch cartilage absent, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 1 from Chen et al., 2019
hindbrain morphology, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 1 from Chen et al., 2019
whole organism mdm2 expression increased amount, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 5 from Chen et al., 2019
whole organism hemoglobin amount, ameliorated	rps9^la490/la490 (AB)	chemical treatment: dexamethasone	Figure 6 from Chen et al., 2019
head rps9 expression decreased amount, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 2 from Chen et al., 2019
integument melanocyte decreased amount, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 1 from Chen et al., 2019
hindbrain increased size, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 1 , Figure 2 from Chen et al., 2019
whole organism hemoglobin decreased amount, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 5 , Figure 6 from Chen et al., 2019
whole organism tp53 expression increased amount, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 5 from Chen et al., 2019
whole organism hemoglobin amount, ameliorated	rps9^la490/la490 (AB)	chemical treatment: L-leucine	Figure 6 from Chen et al., 2019
whole organism cdkn1a expression increased amount, abnormal	rps9^la490/la490 (AB)	standard conditions	Figure 5 from Chen et al., 2019
head cdkn1a expression increased amount, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 5 from Chen et al., 2019
trunk hemoglobin decreased amount, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 3 from Chen et al., 2019
eye decreased size, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 1 from Chen et al., 2019
pericardium edematous, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 1 , Figure 5 from Chen et al., 2019
whole organism rps9 expression decreased amount, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 2 from Chen et al., 2019
trunk shortened, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 1 , Figure 2 , Figure 5 from Chen et al., 2019
pharyngeal arch cartilage absent, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 1 from Chen et al., 2019
hindbrain morphology, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 1 from Chen et al., 2019
whole organism mdm2 expression increased amount, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 5 from Chen et al., 2019
whole organism hemoglobin amount, ameliorated	rps9^la491/la491 (AB)	chemical treatment: dexamethasone	Figure 6 from Chen et al., 2019
head rps9 expression decreased amount, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 2 from Chen et al., 2019
integument melanocyte decreased amount, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 1 from Chen et al., 2019
hindbrain increased size, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 1 , Figure 2 from Chen et al., 2019
whole organism hemoglobin decreased amount, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 5 , Figure 6 from Chen et al., 2019
whole organism tp53 expression increased amount, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 5 from Chen et al., 2019
whole organism hemoglobin amount, ameliorated	rps9^la491/la491 (AB)	chemical treatment: L-leucine	Figure 6 from Chen et al., 2019
whole organism cdkn1a expression increased amount, abnormal	rps9^la491/la491 (AB)	standard conditions	Figure 5 from Chen et al., 2019
nucleate erythrocyte developmental maturation delayed phase, abnormal	rps9^la490/la490; cz3325Tg (AB)	standard conditions	Figure 3 from Chen et al., 2019
heart nucleate erythrocyte decreased amount, abnormal	rps9^la490/la490; cz3325Tg (AB)	standard conditions	Figure 3 from Chen et al., 2019
trunk nucleate erythrocyte absent, abnormal	rps9^la490/la490; cz3325Tg (AB)	standard conditions	Figure 3 from Chen et al., 2019
nucleate erythrocyte decreased amount, abnormal	rps9^la490/la490; cz3325Tg (AB)	standard conditions	Figure 3 from Chen et al., 2019
nucleate erythrocyte developmental maturation delayed phase, abnormal	rps9^la491/la491; cz3325Tg (AB)	standard conditions	Figure 3 from Chen et al., 2019
heart nucleate erythrocyte decreased amount, abnormal	rps9^la491/la491; cz3325Tg (AB)	standard conditions	Figure 3 from Chen et al., 2019
trunk nucleate erythrocyte absent, abnormal	rps9^la491/la491; cz3325Tg (AB)	standard conditions	Figure 3 from Chen et al., 2019
nucleate erythrocyte decreased amount, abnormal	rps9^la491/la491; cz3325Tg (AB)	standard conditions	Figure 3 from Chen et al., 2019
trunk length, ameliorated	rps9^la490/la490 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
whole organism tp53 expression increased amount, abnormal	rps9^la490/la490 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
pericardium morphology, ameliorated	rps9^la490/la490 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
whole organism hemoglobin amount, ameliorated	rps9^la490/la490 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
whole organism cdkn1a expression increased amount, abnormal	rps9^la490/la490 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
whole organism mdm2 expression increased amount, abnormal	rps9^la490/la490 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
trunk length, ameliorated	rps9^la491/la491 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
whole organism tp53 expression increased amount, abnormal	rps9^la491/la491 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
pericardium morphology, ameliorated	rps9^la491/la491 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
whole organism hemoglobin amount, ameliorated	rps9^la491/la491 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
whole organism cdkn1a expression increased amount, abnormal	rps9^la491/la491 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019
whole organism mdm2 expression increased amount, abnormal	rps9^la491/la491 + MO4-tp53 (AB)	control	Figure 5 from Chen et al., 2019

Citations