ZFIN ID: ZDB-CRISPR-200528-18
CRISPR Name: CRISPR1-rx3
Target: rx3 (1)
Source:
Target Sequence:
5' - GAGCTCGTGGAGCTGGAAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets exon 2. The PAM site was "TGG" at the 3' end.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-rx3 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-rx3 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-rx3 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-rx3
No data available

Phenotype of all Fish created by or utilizing CRISPR1-rx3
No data available
Genome Resources:
CITATIONS (1)