CRISPR

CRISPR1-ppargc1a

ID
ZDB-CRISPR-200519-2
Name
CRISPR1-ppargc1a
Previous Names
None
Target
Sequence
5' - GGAAAATGAGGCCAACTTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns176 ppargc1a
Expression
Gene expression in Wild Types + CRISPR1-ppargc1a
No data available
Phenotype
Phenotype resulting from CRISPR1-ppargc1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-ppargc1a
Phenotype Fish Conditions Figures
coronary artery endothelial cell atp5pf expression decreased amount, abnormal ppargc1abns176/bns176; hu5333Tg control Fig. 1 with image from Marín-Juez et al., 2019
coronary artery endothelial cell apln expression increased amount, abnormal ppargc1abns176/bns176; hu5333Tg control Fig. 1 with image from Marín-Juez et al., 2019
coronary artery endothelial cell ppargc1a expression decreased amount, abnormal ppargc1abns176/bns176; hu5333Tg cryoablation: heart Fig. 1 with image from Marín-Juez et al., 2019
coronary artery endothelial cell atp5pf expression decreased amount, abnormal ppargc1abns176/bns176; hu5333Tg cryoablation: heart Fig. 1 with image from Marín-Juez et al., 2019
coronary artery endothelial cell apln expression increased amount, abnormal ppargc1abns176/bns176; hu5333Tg cryoablation: heart Fig. 1 with image from Marín-Juez et al., 2019
regenerating tissue cell population proliferation increased occurrence, abnormal ppargc1abns176/bns176; hu5333Tg cryoablation: heart Fig. 1 with image from Marín-Juez et al., 2019
blood vessel endothelial cell cell population proliferation increased occurrence, abnormal ppargc1abns176/bns176; hu5333Tg cryoablation: heart Fig. 1 with image from Marín-Juez et al., 2019
coronary artery endothelial cell ppargc1a expression decreased amount, abnormal ppargc1abns176/bns176; hu5333Tg control Fig. 1 with image from Marín-Juez et al., 2019
coronary artery endothelial cell ndufb5 expression decreased amount, abnormal ppargc1abns176/bns176; hu5333Tg control Fig. 1 with image from Marín-Juez et al., 2019
coronary artery endothelial cell ndufb5 expression decreased amount, abnormal ppargc1abns176/bns176; hu5333Tg cryoablation: heart Fig. 1 with image from Marín-Juez et al., 2019
Citations