CRISPR

CRISPR2-bbs4

ID

ZDB-CRISPR-200428-1

Name

CRISPR2-bbs4

Previous Names

None

Target

bbs4 (1)

Sequence

5' - AGCTCCTGAGCTTCCCATCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nu210	bbs4

Expression

Gene expression in Wild Types + CRISPR2-bbs4

No data available

Phenotype

Phenotype resulting from CRISPR2-bbs4

Phenotype	Fish	Figures
phototaxis decreased occurrence, abnormal	AB/EKW + CRISPR2-bbs4	Fig. 4 from Tsai et al., 2019
proximal convoluted tubule atrophied, abnormal	AB/EKW + CRISPR2-bbs4	Fig. 2 from Tsai et al., 2019
proximal convoluted tubule morphology, abnormal	AB/EKW + CRISPR2-bbs4	Fig. 2 from Tsai et al., 2019
proximal convoluted tubule development decreased occurrence, abnormal	AB/EKW + CRISPR2-bbs4	Fig. 2 from Tsai et al., 2019
retinal outer nuclear layer cytoplasm ab5-rho labeling mislocalised, abnormal	AB/EKW + CRISPR2-bbs4	Fig. 4 from Tsai et al., 2019

Phenotype of all Fish created by or utilizing CRISPR2-bbs4

Phenotype	Fish	Conditions	Figures
swimming behavior decreased process quality, abnormal	bbs4^nu210/nu210	altered light dark cycle	Fig. 5. from Khan et al., 2025
retinal inner nuclear layer decreased depth, abnormal	bbs4^nu210/nu210	standard conditions	Fig. 6. from Khan et al., 2025
swimming behavior decreased process quality, abnormal	bbs4^nu210/nu210	altered light dark cycle	Fig. 5. from Khan et al., 2025
retinal outer nuclear layer decreased depth, abnormal	bbs4^nu210/nu210	standard conditions	Fig. 6. from Khan et al., 2025
swimming behavior decreased process quality, abnormal	bbs4^nu210/nu210	altered light dark cycle	Fig. 6. from Khan et al., 2025
retinal rod cell photoreceptor inner segment ab5-rho labeling increased amount, abnormal	bbs4^nu210/nu210	standard conditions	Fig. 5. from Khan et al., 2025
proximal convoluted tubule development decreased occurrence, abnormal	AB/EKW + CRISPR2-bbs4	standard conditions	Fig. 2 from Tsai et al., 2019
retinal outer nuclear layer cytoplasm ab5-rho labeling mislocalised, abnormal	AB/EKW + CRISPR2-bbs4	standard conditions	Fig. 4 from Tsai et al., 2019
phototaxis decreased occurrence, abnormal	AB/EKW + CRISPR2-bbs4	standard conditions	Fig. 4 from Tsai et al., 2019
proximal convoluted tubule atrophied, abnormal	AB/EKW + CRISPR2-bbs4	standard conditions	Fig. 2 from Tsai et al., 2019
proximal convoluted tubule morphology, abnormal	AB/EKW + CRISPR2-bbs4	standard conditions	Fig. 2 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated	AB/EKW + CRISPR2-bbs4 + CRISPR2-usp38	standard conditions	Fig. 2 from Tsai et al., 2019
phototaxis decreased occurrence, ameliorated	AB/EKW + CRISPR2-bbs4 + CRISPR2-usp38	standard conditions	Fig. 4 from Tsai et al., 2019
retinal outer nuclear layer ab5-rho labeling position, ameliorated	AB/EKW + CRISPR2-bbs4 + CRISPR2-usp38	standard conditions	Fig. 4 from Tsai et al., 2019
proximal convoluted tubule atrophied, ameliorated	AB/EKW + CRISPR2-bbs4 + CRISPR2-usp38	standard conditions	Fig. 2 from Tsai et al., 2019
proximal convoluted tubule morphology, ameliorated	AB/EKW + CRISPR2-bbs4 + CRISPR2-usp38	standard conditions	Fig. 2 from Tsai et al., 2019

Citations