CRISPR

CRISPR1-kl

ID
ZDB-CRISPR-200415-3
Name
CRISPR1-kl
Previous Names
None
Target
Sequence
5' - GGCTGGAGTAATTCGGTTATGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3212 kl
zf3213 kl
Expression
Gene expression in Wild Types + CRISPR1-kl
No data available
Phenotype
Phenotype resulting from CRISPR1-kl
No data available
Phenotype of all Fish created by or utilizing CRISPR1-kl
Phenotype Fish Conditions Figures
eye protruding, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 1 with image from Singh et al., 2019
heart mmp13a expression increased amount, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 4 with image from Singh et al., 2019
whole organism viability, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 1 with image from Singh et al., 2019
epidermis necrotic, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
whole organism calcified, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
dermis vasculature mineralized, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
kidney kl expression decreased amount, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 3 from Singh et al., 2019
whole organism inflammatory response increased occurrence, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
bone tissue located in pharyngeal arch 3-7, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
eye opaque, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 1 with image from Singh et al., 2019
fin broken, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 1 with image from Singh et al., 2019
swimming decreased occurrence, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 1 with image from Singh et al., 2019
bulbus arteriosus osteoclast increased amount, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
bulbus arteriosus calcified, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
heart entpd5a expression increased amount, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 4 with image from Singh et al., 2019
common bile duct calcified, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
skeletal muscle vasculature mineralized, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
heart ctsk expression increased amount, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 4 with image from Singh et al., 2019
heart mmp9 expression increased amount, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 4 with image from Singh et al., 2019
skeletal muscle degenerate, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
skeletal muscle fibrotic, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
heart spp1 expression increased amount, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 4 with image from Singh et al., 2019
gill fgf23 expression increased amount, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 3 from Singh et al., 2019
heart acp5a expression increased amount, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 4 with image from Singh et al., 2019
bulbus arteriosus spp1 expression mislocalised, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 4 with image from Singh et al., 2019
dermis necrotic, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 2 with image from Singh et al., 2019
whole organism decreased weight, abnormal klzf3212/zf3212 (TU) standard conditions Fig. 1 with image from Singh et al., 2019
eye protruding, abnormal klzf3213/zf3213 (AB) standard conditions Fig. 1 with image from Singh et al., 2019
whole organism viability, abnormal klzf3213/zf3213 (AB) standard conditions Fig. 1 with image from Singh et al., 2019
fin broken, abnormal klzf3213/zf3213 (AB) standard conditions Fig. 1 with image from Singh et al., 2019
swimming decreased occurrence, abnormal klzf3213/zf3213 (AB) standard conditions Fig. 1 with image from Singh et al., 2019
eye opaque, abnormal klzf3213/zf3213 (AB) standard conditions Fig. 1 with image from Singh et al., 2019
whole organism decreased weight, abnormal klzf3213/zf3213 (AB) standard conditions Fig. 1 with image from Singh et al., 2019
Citations