CRISPR

CRISPR2-lnc.cnib1

ID
ZDB-CRISPR-200408-3
Name
CRISPR2-lnc.cnib1
Previous Names
None
Target
Sequence
5' - CTGCTAGCGAGGACACACTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
WARNING: Wang et al. (2019) produced functional evidence that this lncRNA exists and may be conserved The CRISPR and primers sequences to BLAST to the indicated intronic region in pbx3b, however, there is no evidence that any lncRNAs are in this genomic region.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3098 lnc.cnib1
zf3099 lnc.cnib1
Expression
Gene expression in Wild Types + CRISPR2-lnc.cnib1
No data available
Phenotype
Phenotype resulting from CRISPR2-lnc.cnib1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-lnc.cnib1
Phenotype Fish Conditions Figures
whole organism dead, abnormal lnc.cnib1zf3098/zf3098 standard conditions Fig. 3 from Wang et al., 2019
whole organism decreased life span, abnormal lnc.cnib1zf3098/zf3098 standard conditions Fig. 3 from Wang et al., 2019
optokinetic behavior decreased occurrence, abnormal lnc.cnib1zf3098/+ standard conditions Fig. 5 with image from Wang et al., 2019
eye decreased size, abnormal lnc.cnib1zf3098/+ standard conditions Fig. 5 with image from Wang et al., 2019
optokinetic behavior decreased process quality, abnormal lnc.cnib1zf3098/+ standard conditions Fig. 5 with image from Wang et al., 2019
hatching decreased occurrence, abnormal lnc.cnib1zf3098/+ standard conditions Fig. 4 with image from Wang et al., 2019
swimming decreased occurrence, abnormal lnc.cnib1zf3098/+ standard conditions Fig. 4 with image from Wang et al., 2019
whole organism decreased length, abnormal lnc.cnib1zf3098/+ standard conditions Fig. 4 with imageFig. S7 with image from Wang et al., 2019
swimming decreased linear velocity, abnormal lnc.cnib1zf3098/+ standard conditions Fig. 4 with image from Wang et al., 2019
optokinetic behavior decreased occurrence, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 5 with image from Wang et al., 2019
eye decreased size, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 5 with image from Wang et al., 2019
retina dopaminergic neuron decreased amount, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 5 with image from Wang et al., 2019
whole organism decreased life span, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 3 from Wang et al., 2019
whole organism eya2 expression decreased amount, abnormal lnc.cnib1zf3099/+ standard conditions Fig. S13 from Wang et al., 2019
swimming decreased linear velocity, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 4 with image from Wang et al., 2019
hatching decreased occurrence, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 4 with image from Wang et al., 2019
whole organism foxc1a expression decreased amount, abnormal lnc.cnib1zf3099/+ standard conditions Fig. S13 from Wang et al., 2019
optokinetic behavior decreased process quality, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 5 with image from Wang et al., 2019
eye lmx1bb expression decreased amount, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 6 with image from Wang et al., 2019
whole organism decreased length, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 4 with imageFig. S7 with image from Wang et al., 2019
swimming decreased occurrence, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 4 with image from Wang et al., 2019
brain lmx1bb expression decreased amount, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 6 with image from Wang et al., 2019
whole organism dead, abnormal lnc.cnib1zf3099/+ standard conditions Fig. 3 from Wang et al., 2019
whole organism pax8 expression decreased amount, abnormal lnc.cnib1zf3099/+ standard conditions Fig. S13 from Wang et al., 2019
Citations