CRISPR

CRISPR2-myo9aa

ID
ZDB-CRISPR-200116-3
Name
CRISPR2-myo9aa
Previous Names
None
Target
Sequence
5' - GGGCTGGACGGGATAATCGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "Gs" were added to improve binding.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-myo9aa
No data available
Phenotype
Phenotype resulting from CRISPR2-myo9aa
Phenotype Fish Figures
heart edematous, abnormal WT + CRISPR2-myo9aa Fig. 1 with image from O'Connor et al., 2019
whole organism curved, abnormal WT + CRISPR2-myo9aa Fig. 1 with image from O'Connor et al., 2019
Phenotype of all Fish created by or utilizing CRISPR2-myo9aa
Phenotype Fish Conditions Figures
heart edematous, abnormal WT + CRISPR2-myo9aa standard conditions Fig. 1 with image from O'Connor et al., 2019
whole organism curved, abnormal WT + CRISPR2-myo9aa standard conditions Fig. 1 with image from O'Connor et al., 2019
thigmotaxis process quality, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 2 from O'Connor et al., 2019
whole organism movement behavioral quality, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 2 from O'Connor et al., 2019
heart edematous, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 1 with image from O'Connor et al., 2019
motor neuron axon decreased branchiness, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 5 with image from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber size, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. T1 from O'Connor et al., 2019
motor neuron axon branchiness, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 5 with image from O'Connor et al., 2019
horizontal myoseptum synaptic vesicle ab-sv2 labeling absent, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 3 with image from O'Connor et al., 2019
whole organism behavioural activity, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 2 from O'Connor et al., 2019
myotome size, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T1 from O'Connor et al., 2019
whole organism viability, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 2 from O'Connor et al., 2019
motor neuron axon decreased length, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T1 from O'Connor et al., 2019
motor neuron axon decreased length, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 3 with image,  Fig. T1 from O'Connor et al., 2019
horizontal myoseptum synaptic vesicle ab-sv2 labeling amount, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 3 with image from O'Connor et al., 2019
thigmotaxis decreased linear velocity, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 2 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber decreased amount, exacerbated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T2 from O'Connor et al., 2019
motor neuron axon length, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. T1 from O'Connor et al., 2019
myotome decreased size, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T3 from O'Connor et al., 2019
myotome size, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. T3 from O'Connor et al., 2019
thigmotaxis process quality, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 2 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber decreased amount, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 5 with image from O'Connor et al., 2019
horizontal myoseptum synaptic vesicle ab-sv2 labeling amount, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 3 with image from O'Connor et al., 2019
motor neuron axon decreased branchiness, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. 5 with image from O'Connor et al., 2019
myotome decreased size, exacerbated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. T1 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber amount, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 5 with image,  Fig. T2 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber decreased amount, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 4 with image,  Fig. 5 with image,  Fig. T2 from O'Connor et al., 2019
whole organism curved, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 1 with image from O'Connor et al., 2019
whole organism movement behavioral quality, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by injection: peptide Fig. 2 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber size, ameliorated WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab chemical treatment by environment: fasudil hydrochloride Fig. T1 from O'Connor et al., 2019
myotome decreased size, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. T1,  Fig. T3 from O'Connor et al., 2019
horizontal myoseptum neuromuscular junction of skeletal muscle fiber decreased size, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. T1 from O'Connor et al., 2019
myotome synapse ab-sv2 labeling decreased amount, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. T2 from O'Connor et al., 2019
whole organism decreased behavioural activity, abnormal WT + CRISPR1-myo9aa + CRISPR1-myo9ab + CRISPR2-myo9aa + CRISPR2-myo9ab standard conditions Fig. 2 from O'Connor et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.