CRISPR
CRISPR2-myo9aa
- ID
- ZDB-CRISPR-200116-3
- Name
- CRISPR2-myo9aa
- Previous Names
- None
- Target
- Sequence
-
5' - GGGCTGGACGGGATAATCGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The first two "Gs" were added to improve binding.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-myo9aa
No data available
Phenotype
Phenotype resulting from CRISPR2-myo9aa
| Phenotype | Fish | Figures |
|---|---|---|
| heart edematous, abnormal | WT + CRISPR2-myo9aa |
Fig. 1 |
| whole organism curved, abnormal | WT + CRISPR2-myo9aa |
Fig. 1 |
Phenotype of all Fish created by or utilizing CRISPR2-myo9aa
Citations