CRISPR

CRISPR2-alms1

ID

ZDB-CRISPR-191118-4

Name

CRISPR2-alms1

Previous Names

None

Target

alms1 (1)

Sequence

5' - GGTGGTCGTTTAATCGGAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
umd2	alms1

Expression

Gene expression in Wild Types + CRISPR2-alms1

No data available

Phenotype

Phenotype resulting from CRISPR2-alms1

No data available

Phenotype of all Fish created by or utilizing CRISPR2-alms1

Phenotype	Fish	Conditions	Figures
kidney interstitial cell morphology, abnormal	alms1^umd2/umd2	standard conditions	Fig. 2 from Nesmith et al., 2019
photoreceptor activity process quality, abnormal	alms1^umd2/umd2	standard conditions	Fig. 2 from Nesmith et al., 2019
pancreas hyperplastic, abnormal	alms1^umd2/umd2	high fat	Fig. 3 from Nesmith et al., 2019
liver hyperplastic, abnormal	alms1^umd2/umd2	high fat	Fig. 3 from Nesmith et al., 2019
cardiac ventricle morphology, abnormal	alms1^umd2/umd2	standard conditions	Fig. 2 from Nesmith et al., 2019
whole organism insulin increased amount, abnormal	alms1^umd2/umd2	high glucose	Fig. 6 from Nesmith et al., 2019
endocrine pancreas morphology, abnormal	alms1^umd2/umd2	standard conditions	Fig. 4 from Nesmith et al., 2019
liver fatty, abnormal	alms1^umd2/umd2	high fat	Fig. 3 from Nesmith et al., 2019
whole organism increased weight, abnormal	alms1^umd2/umd2	high fat	Fig. 3 from Nesmith et al., 2019
detection of light stimulus involved in sensory perception process quality, abnormal	alms1^umd2/umd2	standard conditions	Fig. 2 from Nesmith et al., 2019
neuromast hair cell decreased amount, abnormal	alms1^umd2/umd2	chemical treatment by environment: neomycin	Fig. 4, Fig. 5 from Parkinson et al., 2021
whole organism insulin increased amount, abnormal	alms1^umd2/umd2	standard conditions	Fig. 6 from Nesmith et al., 2019
retinal photoreceptor layer morphology, abnormal	alms1^umd2/umd2	standard conditions	Fig. 2 from Nesmith et al., 2019
neuromast hair cell decreased amount, abnormal	alms1^umd2/umd2	chemical treatment by environment: gentamycin	Fig. 4 from Parkinson et al., 2021
cardiac ventricle increased thickness, abnormal	alms1^umd2/umd2	standard conditions	Fig. 2 from Nesmith et al., 2019
post-vent region curled, abnormal	alms1^umd2/umd2	standard conditions	Fig. 1 from Nesmith et al., 2019
whole organism increased weight, abnormal	alms1^umd2/umd2	standard conditions	Fig. 3 from Nesmith et al., 2019
renal tubule dilated, abnormal	alms1^umd2/umd2	standard conditions	Fig. 2 from Nesmith et al., 2019
neuromast hair cell decreased amount, abnormal	alms1^umd2/umd2	chemical treatment by environment: neomycin	Fig. 4 from Parkinson et al., 2021
heart edematous, abnormal	alms1^umd2/umd2	standard conditions	Fig. 2, Fig. S1 from Nesmith et al., 2019
pancreatic B cell decreased amount, abnormal	alms1^umd2/umd2; jh2Tg	standard conditions	Fig. 4 from Nesmith et al., 2019
pancreatic B cell decreased amount, abnormal	alms1^umd2/umd2; jh2Tg	high glucose	Fig. 4 from Nesmith et al., 2019

Citations