CRISPR

CRISPR2-sox3

ID

ZDB-CRISPR-191022-1

Name

CRISPR2-sox3

Previous Names

None

Target

sox3 (1)

Sequence

5' - GGTGTCGGTGGGCCAGCGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
whu101	sox3
whu102	sox3

Expression

Gene expression in Wild Types + CRISPR2-sox3

No data available

Phenotype

Phenotype resulting from CRISPR2-sox3

No data available

Phenotype of all Fish created by or utilizing CRISPR2-sox3

Phenotype	Fish	Conditions	Figures
ovary 17beta-estradiol decreased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 5 from Hong et al., 2018
ovary cyp19a1a expression decreased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 5 from Hong et al., 2018
ovary boka expression increased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
ovary casp3a expression increased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
ovary tspo expression increased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
testis 17beta-estradiol decreased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 5 from Hong et al., 2018
granulosa cell apoptotic process increased occurrence, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
ovarian follicle stage IV decreased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 2 from Hong et al., 2018
ovary sox3 expression absent, abnormal	sox3^{whu101/whu101}	standard conditions	Fig. 1 from Hong et al., 2018
ovary Ab19-casp3 labeling increased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
ovarian follicle stage III decreased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 2 from Hong et al., 2018
oocyte stage IV apoptotic process increased occurrence, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
theca cell apoptotic process increased occurrence, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
ovary pmaip1 expression increased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
ovarian follicle development delayed, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 2 from Hong et al., 2018
ovary sox3 expression decreased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Fig. 1 from Hong et al., 2018
ovary capn12 expression increased amount, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
oocyte stage III apoptotic process increased occurrence, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 4 from Hong et al., 2018
female organism decreased fecundity, abnormal	sox3^{whu101/whu101}	standard conditions	Figure 2 from Hong et al., 2018
oocyte stage III apoptotic process increased occurrence, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
ovary boka expression increased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
ovary cyp19a1a expression decreased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 5 from Hong et al., 2018
ovary casp3a expression increased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
ovary 17beta-estradiol decreased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 5 from Hong et al., 2018
testis 17beta-estradiol decreased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 5 from Hong et al., 2018
ovary tspo expression increased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
ovarian follicle stage IV decreased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 2 from Hong et al., 2018
granulosa cell apoptotic process increased occurrence, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
ovary sox3 expression absent, abnormal	sox3^{whu102/whu102}	standard conditions	Fig. 1 from Hong et al., 2018
ovary Ab19-casp3 labeling increased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
ovarian follicle stage III decreased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 2 from Hong et al., 2018
ovarian follicle development delayed, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 2 from Hong et al., 2018
oocyte stage IV apoptotic process increased occurrence, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
theca cell apoptotic process increased occurrence, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
ovary pmaip1 expression increased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
ovary capn12 expression increased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 4 from Hong et al., 2018
ovary sox3 expression decreased amount, abnormal	sox3^{whu102/whu102}	standard conditions	Fig. 1 from Hong et al., 2018
female organism decreased fecundity, abnormal	sox3^{whu102/whu102}	standard conditions	Figure 2 from Hong et al., 2018

Citations