ZFIN ID: ZDB-CRISPR-190917-3
CRISPR Name: CRISPR1-pcf11
Target: pcf11 (1)
Source:
Target Sequence:
5' - ATGGTGAGCATGTTGATGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-pcf11 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-pcf11
Genomic Feature Affected Genomic Regions    
vbc8 pcf11    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-pcf11 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-pcf11
No data available

Phenotype of all Fish created by or utilizing CRISPR1-pcf11
Genome Resources:
CITATIONS (1)