CRISPR

CRISPR2-cog4

ID

ZDB-CRISPR-190913-2

Name

CRISPR2-cog4

Previous Names

None

Target

cog4 (1)

Sequence

5' - GCTCTGCAGGACCTGCAGCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
b1312	cog4

Expression

Gene expression in Wild Types + CRISPR2-cog4

No data available

Phenotype

Phenotype resulting from CRISPR2-cog4

No data available

Phenotype of all Fish created by or utilizing CRISPR2-cog4

Phenotype	Fish	Conditions	Figures
pillar of the lateral semicircular canal absent, abnormal	cog4^b1312/b1312	standard conditions	Fig. S5 from Clément et al., 2018
anterior macula Golgi apparatus structure, abnormal	cog4^b1312/b1312	standard conditions	Fig. S11 from Ferreira et al., 2018
protein N-linked glycosylation process quality, abnormal	cog4^b1312/b1312	standard conditions	Fig. S12 from Ferreira et al., 2018
semicircular canal Collagen present, abnormal	cog4^b1312/b1312	standard conditions	Fig. S5 from Clément et al., 2018
extracellular matrix organization disrupted, abnormal	cog4^b1312/b1312	standard conditions	Fig. 5 , Fig. 6 , Fig. S4 from Clément et al., 2018
otic vesicle protrusion proteoglycan decreased amount, abnormal	cog4^b1312/b1312	standard conditions	Fig. 5 , Fig. S4 from Clément et al., 2018
protein O-linked glycosylation process quality, abnormal	cog4^b1312/b1312	standard conditions	Fig. S12 from Ferreira et al., 2018
otic vesicle ventral protrusion present, abnormal	cog4^b1312/b1312	standard conditions	Fig. S5 from Clément et al., 2018
semicircular canal formation delayed, abnormal	cog4^b1312/b1312	standard conditions	Fig. 3 , Fig. S5 from Clément et al., 2018
inner ear malformed, abnormal	cog4^b1312/b1312	standard conditions	Fig. 6 from Ferreira et al., 2018
otic vesicle protrusion Collagen decreased amount, abnormal	cog4^b1312/b1312	standard conditions	Fig. 6 from Clément et al., 2018
hair cell anterior macula stereocilium bundle decreased amount, abnormal	cog4^b1312/b1312	standard conditions	Fig. 6 from Ferreira et al., 2018
auditory behavior decreased occurrence, abnormal	cog4^b1312/b1312	standard conditions	text only from Ferreira et al., 2018
inner ear morphology, abnormal	cog4^b1312/b1312	standard conditions	Fig. S3 from Clément et al., 2018
inner ear decreased size, abnormal	cog4^b1312/b1312	standard conditions	Fig. 1 from Clément et al., 2018
pillar of the semicircular canal malformed, abnormal	cog4^b1312/b1312	standard conditions	Fig. 1 , Fig. 3 , Fig. S5 from Clément et al., 2018
otic vesicle lacks parts or has fewer parts of type otic vesicle protrusion, abnormal	cog4^b1312/b1312	standard conditions	Fig. 3 from Clément et al., 2018
neuromast hair cell stereocilium bundle decreased amount, abnormal	cog4^b1312/b1312	standard conditions	Fig. 6 from Ferreira et al., 2018
semicircular canal aplastic/hypoplastic, abnormal	cog4^b1312/b1312	standard conditions	Fig. 1 from Clément et al., 2018
whole organism glycosphingolipid decreased amount, abnormal	cog4^b1312/b1312	standard conditions	Fig. S12 from Ferreira et al., 2018
semicircular canal shape, abnormal	cog4^b1312/b1312	standard conditions	Fig. 6 from Ferreira et al., 2018
inner ear lacks parts or has fewer parts of type semicircular canal, abnormal	cog4^b1312/b1312	standard conditions	Fig. 3 from Clément et al., 2018
ceratohyal cartilage chondrocyte disorganized, abnormal	cog4^b1311/+; cog4^b1312/+	standard conditions	Fig. 7 from Ferreira et al., 2018
eye decreased size, abnormal	cog4^b1311/+; cog4^b1312/+	standard conditions	Fig. 7 from Ferreira et al., 2018
mandibular arch skeleton decreased size, abnormal	cog4^b1311/+; cog4^b1312/+	standard conditions	Fig. 7 from Ferreira et al., 2018
inner ear decreased size, abnormal	cog4^b1311/+; cog4^b1312/+	standard conditions	Fig. 7 from Ferreira et al., 2018
pectoral fin decreased length, abnormal	cog4^b1311/+; cog4^b1312/+	standard conditions	Fig. 7 from Ferreira et al., 2018
whole organism decreased length, abnormal	cog4^b1311/+; cog4^b1312/+	standard conditions	Fig. 7 from Ferreira et al., 2018
ceratohyal cartilage chondrocyte morphology, abnormal	cog4^b1311/+; cog4^b1312/+	standard conditions	Fig. 7 from Ferreira et al., 2018
pectoral fin col1a2 expression decreased amount, abnormal	cog4^b1311/+; cog4^b1312/+	standard conditions	Fig. 7 from Ferreira et al., 2018
pectoral fin clavate, abnormal	cog4^b1311/+; cog4^b1312/+	standard conditions	Fig. 7 from Ferreira et al., 2018
hair cell anterior macula cog4 expression decreased amount, abnormal	cog4^b1312/b1312; vu234Tg	standard conditions	Fig. S14 from Ferreira et al., 2018

Citations