header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-190906-12
CRISPR Name: CRISPR3-mcu
Target: mcu (1)
Source:
Target Sequence:
5' - TGTGCCCTGATGCCTCTGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR3-mcu No data available
GENOMIC FEATURES CREATED WITH CRISPR3-mcu No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR3-mcu No data available
PHENOTYPE
Phenotype resulting from CRISPR3-mcu
No data available

Phenotype of all Fish created by or utilizing CRISPR3-mcu
No data available
OTHER CRISPR3-mcu CRISPR PAGES No links to external sites
CITATIONS (1)