ZFIN ID: ZDB-CRISPR-190312-2
CRISPR Name: CRISPR1-alas1
Target: alas1 (1)
Source:
Target Sequence:
5' - GGACATCATCTCGGGCACTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-alas1 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-alas1
Genomic Feature Affected Genomic Regions    
szy1 alas1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-alas1 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-alas1
No data available

Phenotype of all Fish created by or utilizing CRISPR1-alas1
Genome Resources:
CITATIONS (1)