CRISPR

CRISPR1-abcc9

ID
ZDB-CRISPR-190304-3
Name
CRISPR1-abcc9
Previous Names
  • Abcc9_p.G989E (1)
Target
Sequence
5' - GACCATGAGGAAGCCGCCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 4
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hu11838 abcc9
Expression
Gene expression in Wild Types + CRISPR1-abcc9
No data available
Phenotype
Phenotype resulting from CRISPR1-abcc9
No data available
Phenotype of all Fish created by or utilizing CRISPR1-abcc9
Phenotype Fish Conditions Figures
ventricular myocardium ATP-activated inward rectifier potassium channel activity decreased occurrence, abnormal abcc9hu11838/hu11838 standard conditions Fig. 6 with image from Smeland et al., 2019
heart process process quality, abnormal abcc9hu11838/hu11838 standard conditions Fig. S10 with image from Tessadori et al., 2018
cardiac muscle cell ATP-activated inward rectifier potassium channel activity decreased occurrence, abnormal abcc9hu11838/hu11838 standard conditions Fig. 6 with image from Smeland et al., 2019
cardiac ventricle malformed, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
heart contraction decreased magnitude, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
atrium apoptotic process increased occurrence, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
cardiac ventricle increased size, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
pericardium edematous, abnormal abcc9hu11838/hu11838 standard conditions Fig. S10 with image from Tessadori et al., 2018
eye decreased distance eye, abnormal abcc9hu11838/hu11838 standard conditions Fig. 6 with image from Smeland et al., 2019
cardiac ventricle apoptotic process increased occurrence, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
swimming decreased process quality, abnormal abcc9hu11838/hu11838 standard conditions Fig. 6 with image from Smeland et al., 2019
eye increased distance eye, abnormal abcc9hu11838/hu11838 (TL) control Figure 4 with image from Efthymiou et al., 2024
eye decreased diameter, abnormal abcc9hu11838/hu11838 (TL) control Figure 4 with image from Efthymiou et al., 2024
swimming behavior process quality, abnormal abcc9hu11838/hu11838 (TL) control Figure 4 with image from Efthymiou et al., 2024
whole organism decreased length, abnormal abcc9hu11838/hu11838 (TL) control Figure 4 with image from Efthymiou et al., 2024
swimming behavior increased process quality, exacerbated abcc9hu11838/hu11838 (TL) chemical treatment by environment: pentetrazol Figure 4 with image from Efthymiou et al., 2024
heart process process quality, abnormal abcc9hu11838/+ standard conditions Fig. S10 with image from Tessadori et al., 2018
pericardium edematous, abnormal abcc9hu11838/+ standard conditions Fig. S10 with image from Tessadori et al., 2018
regulation of potassium:proton exchanging ATPase activity decreased process quality, abnormal abcc9hu11838/hu11838; p151Tg/p151Tg primary cell culture: atrial myocardium Fig. 5 from Singareddy et al., 2021
regulation of potassium:proton exchanging ATPase activity decreased process quality, abnormal abcc9hu11838/hu11838; p151Tg/p151Tg primary cell culture: ventricular myocardium Fig. 4 from Singareddy et al., 2021
Citations