CRISPR

CRISPR1-abcc9

ID
ZDB-CRISPR-190304-3
Name
CRISPR1-abcc9
Previous Names
  • Abcc9_p.G989E (1)
Target
Sequence
5' - GACCATGAGGAAGCCGCCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hu11838 abcc9
Expression
Gene expression in Wild Types + CRISPR1-abcc9
No data available
Phenotype
Phenotype resulting from CRISPR1-abcc9
No data available
Phenotype of all Fish created by or utilizing CRISPR1-abcc9
Phenotype Fish Conditions Figures
ventricular myocardium ATP-activated inward rectifier potassium channel activity decreased occurrence, abnormal abcc9hu11838/hu11838 standard conditions Fig. 6 with image from Smeland et al., 2019
heart process process quality, abnormal abcc9hu11838/hu11838 standard conditions Fig. S10 with image from Tessadori et al., 2018
cardiac muscle cell ATP-activated inward rectifier potassium channel activity decreased occurrence, abnormal abcc9hu11838/hu11838 standard conditions Fig. 6 with image from Smeland et al., 2019
cardiac ventricle malformed, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
heart contraction decreased magnitude, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
atrium apoptotic process increased occurrence, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
cardiac ventricle increased size, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
pericardium edematous, abnormal abcc9hu11838/hu11838 standard conditions Fig. S10 with image from Tessadori et al., 2018
eye decreased distance eye, abnormal abcc9hu11838/hu11838 standard conditions Fig. 6 with image from Smeland et al., 2019
cardiac ventricle apoptotic process increased occurrence, abnormal abcc9hu11838/hu11838 standard conditions Fig. 7 with image from Smeland et al., 2019
swimming decreased process quality, abnormal abcc9hu11838/hu11838 standard conditions Fig. 6 with image from Smeland et al., 2019
eye increased distance eye, abnormal abcc9hu11838/hu11838 (TL) control Figure 4 with image from Efthymiou et al., 2024
eye decreased diameter, abnormal abcc9hu11838/hu11838 (TL) control Figure 4 with image from Efthymiou et al., 2024
swimming behavior process quality, abnormal abcc9hu11838/hu11838 (TL) control Figure 4 with image from Efthymiou et al., 2024
whole organism decreased length, abnormal abcc9hu11838/hu11838 (TL) control Figure 4 with image from Efthymiou et al., 2024
swimming behavior increased process quality, exacerbated abcc9hu11838/hu11838 (TL) chemical treatment by environment: pentetrazol Figure 4 with image from Efthymiou et al., 2024
heart process process quality, abnormal abcc9hu11838/+ standard conditions Fig. S10 with image from Tessadori et al., 2018
pericardium edematous, abnormal abcc9hu11838/+ standard conditions Fig. S10 with image from Tessadori et al., 2018
regulation of potassium:proton exchanging ATPase activity decreased process quality, abnormal abcc9hu11838/hu11838; p151Tg/p151Tg primary cell culture: atrial myocardium Fig. 5 from Singareddy et al., 2021
regulation of potassium:proton exchanging ATPase activity decreased process quality, abnormal abcc9hu11838/hu11838; p151Tg/p151Tg primary cell culture: ventricular myocardium Fig. 4 from Singareddy et al., 2021
Citations