CRISPR

CRISPR1-epas1a

ID
ZDB-CRISPR-180919-2
Name
CRISPR1-epas1a
Previous Names
None
Target
Sequence
5' - CAAAAATGGAGGCTACGTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns231 epas1a
Expression
Gene expression in Wild Types + CRISPR1-epas1a
No data available
Phenotype
Phenotype resulting from CRISPR1-epas1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-epas1a
Phenotype Fish Conditions Figures
whole organism runx1 expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 4 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
whole organism gata2b expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 control Fig. 5 from Gerri et al., 2018
hematopoietic progenitor cell differentiation decreased occurrence, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
whole organism notch1a expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 control Fig. 5 from Gerri et al., 2018
whole organism notch1b expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 control Fig. 5 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
whole organism myb expression decreased amount, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 4 from Gerri et al., 2018
hemopoiesis decreased occurrence, abnormal epas1abns231/bns231 ; epas1bbns232/bns232 standard conditions Fig. 1 from Gerri et al., 2018
Citations