CRISPR

CRISPR1-mir223

ID

ZDB-CRISPR-180706-1

Name

CRISPR1-mir223

Previous Names

None

Target

mir223 (1)

Sequence

5' - TTAGAGTATTTGACAGACTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 5

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
pu18	mir223

Expression

Gene expression in Wild Types + CRISPR1-mir223

No data available

Phenotype

Phenotype resulting from CRISPR1-mir223

No data available

Phenotype of all Fish created by or utilizing CRISPR1-mir223

Phenotype	Fish	Conditions	Figures
whole organism cul1a expression increased amount, abnormal	mir223^pu18/pu18	transection: caudal fin	Fig. 3 from Zhou et al., 2018
neutrophil chemotaxis process efficacy, ameliorated	mir223^pu18/pu18	transection: caudal fin, chemical treatment: NF-kappaB inhibitor	Fig. 3 from Zhou et al., 2018
whole organism traf6 expression increased amount, abnormal	mir223^pu18/pu18	transection: caudal fin	Fig. 3 from Zhou et al., 2018
neutrophil chemotaxis increased efficacy, abnormal	mir223^pu18/pu18	transection: caudal fin	Fig. 1 , Fig. 2 , Fig. 3 from Zhou et al., 2018
caudal fin neutrophil increased amount, exacerbated	mir223^pu18/pu18	transection: caudal fin	Fig. 1 , Fig. 2 , Fig. 3 from Zhou et al., 2018
fin regeneration increased efficacy, abnormal	mir223^pu18/pu18	transection: caudal fin	Fig. 6 from Zhou et al., 2018
caudal fin neutrophil increased amount, ameliorated	mir223^pu18/pu18	transection: caudal fin, chemical treatment: NF-kappaB inhibitor	Fig. 3 from Zhou et al., 2018
regenerating fin increased length, abnormal	mir223^pu18/pu18	transection: caudal fin	Fig. 6 from Zhou et al., 2018
caudal fin canonical NF-kappaB signal transduction increased process quality, abnormal	mir223^pu18/pu18; nc1Tg	control	Fig. 4 from Zhou et al., 2018
caudal fin EGFP expression increased amount, abnormal	mir223^pu18/pu18; nc1Tg	control	Fig. 4 from Zhou et al., 2018
caudal fin canonical NF-kappaB signal transduction increased process quality, abnormal	mir223^pu18/pu18; nc1Tg	transection: caudal fin	Fig. 4 from Zhou et al., 2018
caudal fin EGFP expression increased amount, abnormal	mir223^pu18/pu18; nc1Tg	transection: caudal fin	Fig. 4 from Zhou et al., 2018
neutrophil chemotaxis process efficacy, ameliorated	mir223^pu18/pu18 + CRISPR7-myd88 + CRISPR8-myd88	transection: caudal fin	Fig. 3 from Zhou et al., 2018
caudal fin neutrophil increased amount, ameliorated	mir223^pu18/pu18 + CRISPR7-myd88 + CRISPR8-myd88	transection: caudal fin	Fig. 3 from Zhou et al., 2018
caudal fin neutrophil increased amount, ameliorated	mir223^pu18/pu18 + CRISPR1-cul1a + CRISPR1-cul1b + CRISPR2-cul1a + CRISPR2-cul1b	transection: caudal fin	Fig. 3 from Zhou et al., 2018
neutrophil chemotaxis process efficacy, ameliorated	mir223^pu18/pu18 + CRISPR1-cul1a + CRISPR1-cul1b + CRISPR2-cul1a + CRISPR2-cul1b	transection: caudal fin	Fig. 3 from Zhou et al., 2018
caudal fin neutrophil increased amount, ameliorated	mir223^pu18/pu18; pu9Tg	transection: caudal fin	Fig. 2 from Zhou et al., 2018
neutrophil chemotaxis process efficacy, ameliorated	mir223^pu18/pu18; pu9Tg	transection: caudal fin	Fig. 2 from Zhou et al., 2018
caudal fin EGFP expression amount, ameliorated	mir223^pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b	transection: caudal fin	Fig. 4 from Zhou et al., 2018
caudal fin canonical NF-kappaB signal transduction process quality, ameliorated	mir223^pu18/pu18; nc1Tg + MO1-rac2 + MO1-spi1b	transection: caudal fin	Fig. 4 from Zhou et al., 2018

Citations

Include unpublished citations

Zhou, W., Pal, A.S., Hsu, A.Y., Gurol, T., Zhu, X., Wirbisky-Hershberger, S.E., Freeman, J.L., Kasinski, A.L., Deng, Q. (2018) MicroRNA-223 Suppresses the Canonical NF-κB Pathway in Basal Keratinocytes to Dampen Neutrophilic Inflammation. Cell Reports. 22:1810-1823

1 - 1 of 1

Show