CRISPR

CRISPR1-tgfb1b

ID
ZDB-CRISPR-180613-3
Name
CRISPR1-tgfb1b
Previous Names
None
Target
Sequence
5' - GGAACCAGAAGTAGAAGAGAAGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf2126 tgfb1b
Expression
Gene expression in Wild Types + CRISPR1-tgfb1b
No data available
Phenotype
Phenotype resulting from CRISPR1-tgfb1b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tgfb1b
Phenotype Fish Conditions Figures
whole organism foxo3a expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
whole organism gpx4b expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism gpx1a expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism gpx4a expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta myb expression decreased distribution, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 1 from Zhang et al., 2017
erythrocyte differentiation decreased occurrence, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 2 from Zhang et al., 2017
whole organism nox1 expression increased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism foxo4 expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
ventral wall of dorsal aorta tal1 expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 4,  Fig. 6 from Zhang et al., 2017
whole organism gpx7 expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism ddit3 expression increased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism foxo1a expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
ventral wall of dorsal aorta jun expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 4 from Zhang et al., 2017
ventral wall of dorsal aorta runx1 expression amount, ameliorated tgfb1bzf2126/zf2126 chemical treatment: glucose Fig. 6 from Zhang et al., 2017
whole organism eif2ak3 expression increased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism hsp90b1 expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
JNK cascade decreased occurrence, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 4 from Zhang et al., 2017
whole organism akt2 expression increased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
whole organism foxo3b expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
whole organism gpx1b expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism ern1 expression increased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
definitive hemopoiesis decreased occurrence, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 1 from Zhang et al., 2017
whole organism ccnd2a expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
whole organism pck2 expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism gadd45aa expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
whole organism bcl2l11 expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
whole organism me1 expression increased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta g6pc3 expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
whole organism gpx3 expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism g6pc3 expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
ventral wall of dorsal aorta tal1 expression decreased distribution, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 2 from Zhang et al., 2017
whole organism idh2 expression increased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
myeloid cell differentiation decreased occurrence, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 1,  Fig. 2,  Fig. 4 from Zhang et al., 2017
hematopoietic stem cell decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 1 from Zhang et al., 2017
blood glucose decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
whole organism foxo1b expression decreased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 5 from Zhang et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal tgfb1bzf2126/zf2126 control Fig. 4,  Fig. 6 from Zhang et al., 2017
lymphoid progenitor cell differentiation decreased occurrence, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 2 from Zhang et al., 2017
whole organism atf6 expression increased amount, abnormal tgfb1bzf2126/zf2126 standard conditions Fig. 6 from Zhang et al., 2017
endothelial cell g6pc3 expression decreased amount, abnormal tgfb1bzf2126/zf2126; s843Tg standard conditions Fig. 5 from Zhang et al., 2017
endothelial cell map3k7 expression decreased amount, abnormal tgfb1bzf2126/zf2126; y1Tg standard conditions Fig. 4 from Zhang et al., 2017
endothelial cell mapk9 expression decreased amount, abnormal tgfb1bzf2126/zf2126; y1Tg standard conditions Fig. 4 from Zhang et al., 2017
endothelial cell jun expression decreased amount, abnormal tgfb1bzf2126/zf2126; y1Tg standard conditions Fig. 4 from Zhang et al., 2017
endothelial cell mapk10 expression decreased amount, abnormal tgfb1bzf2126/zf2126; y1Tg standard conditions Fig. 4 from Zhang et al., 2017
endothelial cell mapk8a expression decreased amount, abnormal tgfb1bzf2126/zf2126; y1Tg standard conditions Fig. 4 from Zhang et al., 2017
caudal hematopoietic tissue hematopoietic stem cell decreased amount, abnormal tgfb1bzf2126/zf2126; zf2072Tg; zf2128Tg standard conditions Fig. 2 from Zhang et al., 2017
hematopoietic stem cell decreased amount, abnormal tgfb1bzf2126/zf2126; zf2072Tg; zf2128Tg standard conditions Fig. 4 from Zhang et al., 2017
hematopoietic stem cell amount, ameliorated tgfb1bzf2126/zf2126; zf2128Tg chemical treatment: glucose Fig. 6 from Zhang et al., 2017
definitive hemopoiesis decreased occurrence, abnormal tgfb1bzf2126/zf2126; zf2128Tg standard conditions Fig. 1 from Zhang et al., 2017
caudal hematopoietic tissue GFP expression decreased distribution, abnormal tgfb1bzf2126/zf2126; zf2128Tg standard conditions Fig. 1 from Zhang et al., 2017
hematopoietic stem cell decreased amount, abnormal tgfb1bzf2126/zf2126; zf2128Tg standard conditions Fig. 1,  Fig. 6 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal tgfb1bzf2126/zf2126; zf169Tg; zf2072Tg standard conditions Fig. 2 from Zhang et al., 2017
Citations