CRISPR

CRISPR2-ar

ID

ZDB-CRISPR-180606-2

Name

CRISPR2-ar

Previous Names

None

Target

ar (1)

Sequence

5' - GGGTACCACTGCTCGTGCGGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uab105	ar
uab142	ar

Expression

Gene expression in Wild Types + CRISPR2-ar

No data available

Phenotype

Phenotype resulting from CRISPR2-ar

No data available

Phenotype of all Fish created by or utilizing CRISPR2-ar

Phenotype	Fish	Conditions	Figures
female organism oocyte maturation process quality, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 5 from Crowder et al., 2017
female organism ovary has fewer parts of type oocyte stage III, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 5 from Crowder et al., 2017
male organism trunk obtuse, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 1 from Crowder et al., 2017
male sex determination decreased occurrence, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 2 from Crowder et al., 2017
male organism development of secondary male sexual characteristics decreased occurrence, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 1 from Crowder et al., 2017
testis spermatid development delayed, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 7 from Crowder et al., 2017
male organism development of secondary female sexual characteristics increased occurrence, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 1 from Crowder et al., 2017
ovary oocyte maturation delayed, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 7 from Crowder et al., 2017
male organism spermatogenic cyst malformed, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 4 from Crowder et al., 2017
female sex determination increased occurrence, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 2 from Crowder et al., 2017
male organism testis foxl2a expression increased amount, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 8 from Crowder et al., 2017
male organism seminiferous tubule malformed, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 4 from Crowder et al., 2017
male organism anal fin white, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 1 from Crowder et al., 2017
male organism testis dmrt1 expression decreased amount, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 8 from Crowder et al., 2017
female organism ovary cyp19a1a expression decreased amount, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 8 from Crowder et al., 2017
male organism testis amh expression decreased amount, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 8 from Crowder et al., 2017
male organism sperm ejaculation arrested, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 3 from Crowder et al., 2017
male organism spermatogenic cyst disorganized, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 4 from Crowder et al., 2017
female organism decreased fecundity, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 5 from Crowder et al., 2017
female organism ovary lacks all parts of type oocyte stage III, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 7 from Crowder et al., 2017
female organism ovary dmrt1 expression increased amount, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 8 from Crowder et al., 2017
male organism seminiferous tubule disorganized, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 4 from Crowder et al., 2017
female organism ovary has extra parts of type oocyte stage I, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 5 from Crowder et al., 2017
testis lacks all parts of type spermatid, abnormal	ar^{uab105/uab105} (AB)	standard conditions	Fig. 7 from Crowder et al., 2017
female sex determination decreased occurrence, abnormal	ar^uab105/+ (AB)	standard conditions	Fig. 2 from Crowder et al., 2017
male sex determination increased occurrence, abnormal	ar^uab105/+ (AB)	standard conditions	Fig. 2 from Crowder et al., 2017

Citations