CRISPR

CRISPR1-csrp3

ID

ZDB-CRISPR-180604-1

Name

CRISPR1-csrp3

Previous Names

None

Target

csrp3 (1)

Sequence

5' - GGTCCGAAAGGTTATGGGTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
fdu30	csrp3
ihb244	csrp3
ihb245	csrp3

Expression

Gene expression in Wild Types + CRISPR1-csrp3

No data available

Phenotype

Phenotype resulting from CRISPR1-csrp3

No data available

Phenotype of all Fish created by or utilizing CRISPR1-csrp3

Phenotype	Fish	Conditions	Figures
skeletal muscle tcap expression amount, ameliorated	csrp3^fdu30/fdu30	mechanical stress, chemical treatment by environment: bleaching agent	Fig. 3 from Chang et al., 2019
whole organism tcap expression amount, ameliorated	csrp3^fdu30/fdu30	mechanical stress, chemical treatment by environment: bleaching agent	Fig. 3 from Chang et al., 2019
skeletal muscle skeletal muscle myofibril spatial pattern, abnormal	csrp3^fdu30/fdu30	standard conditions	Fig. 2 from Chang et al., 2019
response to muscle stretch process quality, abnormal	csrp3^fdu30/fdu30	mechanical stress, chemical treatment by environment: bleaching agent	Fig. 3 from Chang et al., 2019
whole organism csrp3 expression decreased amount, abnormal	csrp3^fdu30/fdu30	mechanical stress, chemical treatment by environment: bleaching agent	Fig. 3 from Chang et al., 2019
response to muscle stretch increased process quality, abnormal	csrp3^fdu30/fdu30	mechanical stress, chemical treatment by environment: bleaching agent	Fig. 3 from Chang et al., 2019
skeletal muscle skeletal muscle myofibril detached from myoseptum, exacerbated	csrp3^fdu30/fdu30	mechanical stress, chemical treatment by environment: bleaching agent	Fig. 3 from Chang et al., 2019
heart csrp3 expression absent, abnormal	csrp3^fdu30/fdu30	standard conditions	Fig. 2 from Chang et al., 2019
whole organism nppb expression amount, ameliorated	csrp3^fdu30/fdu30	mechanical stress, chemical treatment by environment: bleaching agent	Fig. 3 from Chang et al., 2019
skeletal muscle skeletal muscle myofibril decreased width, abnormal	csrp3^fdu30/fdu30	standard conditions	Fig. 2 from Chang et al., 2019
detection of muscle stretch process quality, abnormal	csrp3^fdu30/fdu30	mechanical stress, chemical treatment by environment: bleaching agent	Fig. 3 from Chang et al., 2019
cardiac ventricle csrp3 expression absent, abnormal	csrp3^fdu30/fdu30	standard conditions	Fig. 2 from Chang et al., 2019
skeletal muscle skeletal muscle myofibril spatial pattern, exacerbated	csrp3^fdu30/fdu30	mechanical stress, chemical treatment by environment: bleaching agent	Fig. 3 from Chang et al., 2019
skeletal muscle skeletal muscle myofibril kinked, abnormal	csrp3^fdu30 + MO1-ilk	standard conditions	Fig. 4 from Chang et al., 2019
trunk musculature skeletal muscle structure, abnormal	csrp3^fdu30 + MO1-ilk	standard conditions	Fig. 4 from Chang et al., 2019
skeletal muscle cell disorganized, exacerbated	csrp3^fdu30 + MO1-ilk	standard conditions	Fig. 4 from Chang et al., 2019
pericardium edematous, abnormal	csrp3^fdu30 + MO1-ilk	standard conditions	Fig. 4 from Chang et al., 2019
skeletal muscle tcap expression amount, ameliorated	csrp3^fdu30 + MO1-ilk	control	Fig. 4 from Chang et al., 2019
skeletal muscle skeletal muscle myofibril undulate, abnormal	csrp3^fdu30 + MO1-ilk	standard conditions	Fig. 4 from Chang et al., 2019

Citations