CRISPR

CRISPR1-cd44a

ID
ZDB-CRISPR-180517-7
Name
CRISPR1-cd44a
Previous Names
None
Target
Sequence
5' - GGTGAACTGTGTCAGAGTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb231 cd44a
ihb232 cd44a
zf3632 cd44a
zf3633 cd44a
Expression
Gene expression in Wild Types + CRISPR1-cd44a
No data available
Phenotype
Phenotype resulting from CRISPR1-cd44a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cd44a
Phenotype Fish Conditions Figures
whole organism defbl2 expression decreased amount, abnormal cd44azf3632/zf3632 standard conditions Fig. 2 with image from Cao et al., 2022
whole organism lyz expression decreased amount, abnormal cd44azf3632/zf3632 standard conditions Fig. 2 with image from Cao et al., 2022
whole organism nod1 expression decreased amount, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 1 with image from Cao et al., 2022
whole organism mapk7 expression decreased amount, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism viability, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 1 with image from Cao et al., 2022
whole organism defbl2 expression decreased amount, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism pglyrp6 expression decreased amount, abnormal cd44azf3632/zf3632 standard conditions Fig. 2 with image from Cao et al., 2022
whole organism pglyrp6 expression decreased amount, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism mapk3 expression decreased amount, abnormal cd44azf3632/zf3632 standard conditions Fig. 2 with image from Cao et al., 2022
whole organism lyz expression decreased amount, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism nod2 expression decreased amount, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism defbl2 expression increased amount, abnormal cd44azf3632/zf3632 standard conditions Fig. 2 with image from Cao et al., 2022
whole organism nfkbiab expression decreased amount, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism nod1 expression decreased amount, abnormal cd44azf3632/zf3632 standard conditions Fig. 1 with image from Cao et al., 2022
whole organism nfkb1 expression decreased amount, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism mapk3 expression decreased amount, abnormal cd44azf3632/zf3632 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism nod2 expression decreased amount, abnormal cd44azf3632/zf3632 standard conditions Fig. 2 with image from Cao et al., 2022
whole organism mapk7 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism ccnb3 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism sesn1 expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism cdk1 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
cell death decreased process quality, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 3 with image from Cao et al., 2022
whole organism ccne1 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism casp22 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 7 with image from Cao et al., 2022
whole organism nod1 expression decreased amount, abnormal cd44azf3633/zf3633 standard conditions Fig. 1 with image from Cao et al., 2022
whole organism bnip3 expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
whole organism viability, ameliorated cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida, chemical treatment by environment: chloroquine Fig. 4 with image from Cao et al., 2022
whole organism lyz expression decreased amount, abnormal cd44azf3633/zf3633 standard conditions Fig. 2 with image from Cao et al., 2022
whole organism atg13 expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
whole organism nfkb1 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
defense response to bacterium decreased efficacy, ameliorated cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida, chemical treatment by environment: chloroquine Fig. 4 with image from Cao et al., 2022
whole organism nod1 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 1 with image from Cao et al., 2022
whole organism casp9 expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
regulation of programmed cell death increased occurrence, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 7 with image from Cao et al., 2022
regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator decreased process quality, abnormal cd44azf3633/zf3633 standard conditions Fig. 3 with image from Cao et al., 2022
cell growth decreased occurrence, abnormal cd44azf3633/zf3633 standard conditions Fig. 3 with image from Cao et al., 2022
whole organism defbl2 expression decreased amount, abnormal cd44azf3633/zf3633 standard conditions Fig. 2 with image from Cao et al., 2022
cell death decreased process quality, abnormal cd44azf3633/zf3633 standard conditions Fig. 3 with image from Cao et al., 2022
whole organism lyz expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism viability, exacerbated cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida, chemical treatment by environment: sirolimus Fig. 4 with image from Cao et al., 2022
whole organism atg9b expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
whole organism tp53 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image,  Fig. 7 with image from Cao et al., 2022
whole organism dnm1l expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image,  Fig. 7 with image from Cao et al., 2022
cell growth decreased occurrence, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 3 with image from Cao et al., 2022
whole organism birc6 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 7 with image from Cao et al., 2022
whole organism ctsf expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 7 with image from Cao et al., 2022
defense response to bacterium decreased efficacy, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
whole organism chek2 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism casp8 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image,  Fig. 7 with image from Cao et al., 2022
whole organism vamp8 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator decreased process quality, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 3 with image from Cao et al., 2022
whole organism cdk2 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism igf1rb expression amount, ameliorated cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida, chemical treatment by environment: chloroquine Fig. 4 with image from Cao et al., 2022
whole organism mapk3 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism atg10 expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
whole organism viability, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 1 with image,  Fig. 4 with image from Cao et al., 2022
whole organism ccne2 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism atg10 expression amount, ameliorated cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida, chemical treatment by environment: chloroquine Fig. 4 with image from Cao et al., 2022
whole organism bid expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism ccnb1 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism dnm1l expression amount, ameliorated cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida, chemical treatment by environment: chloroquine Fig. 4 with image from Cao et al., 2022
signal transduction by p53 class mediator decreased occurrence, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism pglyrp6 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism chek1 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism nfkbiab expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism defbl2 expression increased amount, abnormal cd44azf3633/zf3633 standard conditions Fig. 2 with image from Cao et al., 2022
whole organism baxa expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 5 with image from Cao et al., 2022
whole organism ptpn13 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 7 with image from Cao et al., 2022
whole organism mtmr14 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
whole organism tbc1d15 expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
whole organism ddit4 expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
whole organism igf1rb expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 4 with image from Cao et al., 2022
whole organism pglyrp6 expression decreased amount, abnormal cd44azf3633/zf3633 standard conditions Fig. 2 with image from Cao et al., 2022
whole organism aifm1 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 7 with image from Cao et al., 2022
whole organism nfkb1 expression increased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
whole organism defbl2 expression decreased amount, abnormal cd44azf3633/zf3633 bacterial treatment by injection: Edwardsiella piscicida Fig. 2 with image from Cao et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.