CRISPR

CRISPR1-aldh7a1

ID

ZDB-CRISPR-180207-4

Name

CRISPR1-aldh7a1

Previous Names

None

Target

aldh7a1 (1)

Sequence

5' - GGACTTAAAGAGGACAATGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ot100	aldh7a1

Expression

Gene expression in Wild Types + CRISPR1-aldh7a1

No data available

Phenotype

Phenotype resulting from CRISPR1-aldh7a1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-aldh7a1

Phenotype	Fish	Conditions	Figures
whole organism life span, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: pyridoxine	Fig. 4 from Pena et al., 2017
whole organism dead, abnormal	aldh7a1^ot100/ot100	chemical treatment by environment: pyridoxal 5'-phosphate	Fig. 4 from Pena et al., 2017
whole organism ab4-fos labeling amount, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: pyridoxine	Fig. 4 from Pena et al., 2017
whole organism behavioural activity, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: lysine, chemical treatment by environment: pyridoxine	Fig. 5 from Pena et al., 2017
whole organism methionine decreased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 6 from Pena et al., 2017
whole organism alpha-aminobutyric acid decreased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 6 from Pena et al., 2017
optic tectum electric potential, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 3 from Pena et al., 2017
whole organism serine increased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 6 from Pena et al., 2017
swimming behavior process quality, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: lysine, chemical treatment by environment: pyridoxine	Fig. 5 from Pena et al., 2017
swimming behavior process quality, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: pyridoxine	Fig. 4 from Pena et al., 2017
whole organism dead, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 2 from Pena et al., 2017
whole organism tyrosine increased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 6 from Pena et al., 2017
whole organism life span, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: pyridoxal 5'-phosphate	Fig. 4 from Pena et al., 2017
whole organism gamma-aminobutyric acid decreased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 6 , Fig. 8 from Pena et al., 2017
whole organism gamma-aminobutyric acid normal amount, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: pyridoxine	Fig. 8 from Pena et al., 2017
swimming behavior process quality, abnormal	aldh7a1^ot100/ot100	lighting conditions	Fig. 3 from Pena et al., 2017
optic tectum electric potential, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: pyridoxine	Fig. 4 from Pena et al., 2017
whole organism beta-alanine increased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 6 from Pena et al., 2017
whole organism circling, abnormal	aldh7a1^ot100/ot100	lighting conditions	Fig. 3 from Pena et al., 2017
trunk curved, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 2 from Pena et al., 2017
whole organism taurine decreased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 6 from Pena et al., 2017
whole organism pyridoxamine 5'-phosphate decreased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 7 from Pena et al., 2017
whole organism decreased life span, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 2 from Pena et al., 2017
swimming behavior process quality, abnormal	aldh7a1^ot100/ot100	chemical treatment by environment: lysine	Fig. 5 from Pena et al., 2017
whole organism increased behavioural activity, abnormal	aldh7a1^ot100/ot100	chemical treatment by environment: lysine	Fig. 5 from Pena et al., 2017
whole organism increased behavioural activity, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 2 from Pena et al., 2017
whole organism L-saccharopine increased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 6 from Pena et al., 2017
whole organism increased behavioural activity, abnormal	aldh7a1^ot100/ot100	lighting conditions	Fig. 3 from Pena et al., 2017
swimming behavior process quality, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 2 from Pena et al., 2017
whole organism 1-piperideine-6-carboxylic acid increased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 2 , Fig. 6 , Fig. 8 from Pena et al., 2017
whole organism life span, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: lysine, chemical treatment by environment: pyridoxine	Fig. 5 from Pena et al., 2017
optic tectum electric potential, abnormal	aldh7a1^ot100/ot100	chemical treatment by environment: tubocurarine	Fig. S8 from Pena et al., 2017
whole organism dead, abnormal	aldh7a1^ot100/ot100	chemical treatment by environment: lysine	Fig. 5 from Pena et al., 2017
whole organism pyridoxal decreased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 7 from Pena et al., 2017
whole organism ab4-fos labeling increased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 4 from Pena et al., 2017
whole organism pipecolate increased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 6 from Pena et al., 2017
whole organism behavioural activity, ameliorated	aldh7a1^ot100/ot100	chemical treatment by environment: pyridoxine	Fig. 4 from Pena et al., 2017
whole organism allysine increased amount, abnormal	aldh7a1^ot100/ot100	standard conditions	Fig. 2 from Pena et al., 2017
whole organism 1-piperideine-6-carboxylic acid increased amount, abnormal	aldh7a1^ot100/ot100	chemical treatment by environment: pyridoxine	Fig. 8 from Pena et al., 2017
whole organism decreased life span, abnormal	aldh7a1^ot100/ot100	chemical treatment by environment: lysine	Fig. 5 from Pena et al., 2017

Citations