ZFIN ID: ZDB-CRISPR-171215-3
CRISPR Name: CRISPR3-pax2a
Target: pax2a (1)
Previous Name: target 3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GCTACATAATCAAGGCGAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR3-pax2a No data available
GENOMIC FEATURES CREATED WITH CRISPR3-pax2a
Genomic Feature Affected Genomic Regions    
uy221Tg pax2a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR3-pax2a No data available
PHENOTYPE
Phenotype resulting from CRISPR3-pax2a
No data available

Phenotype of all Fish created by or utilizing CRISPR3-pax2a
Phenotype Fish Conditions Figures
thyroid follicle morphology, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 3 with image from Ota et al., 2016
thyroid follicle EGFP expression decreased distribution, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 3 with image from Ota et al., 2016
midbrain EGFP expression increased distribution, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 2 with imageFig. 3 with image from Ota et al., 2016
midbrain hindbrain boundary EGFP expression absent, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 3 with image from Ota et al., 2016
midbrain hindbrain boundary pax2a expression absent, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 2 with image from Ota et al., 2016
midbrain hindbrain boundary absent, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 2 with imageFig. 3 with image from Ota et al., 2016
optic chiasm cranial nerve II malformed, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 3 with image from Ota et al., 2016
cranial nerve II neuron projection physical object quality, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 3 with image from Ota et al., 2016
midbrain EGFP expression spatial pattern, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 2 with imageFig. 3 with image from Ota et al., 2016
optic chiasm EGFP expression absent, abnormal pax2auy221Tg/uy221Tg standard conditions Fig. 3 with image from Ota et al., 2016
OTHER CRISPR3-pax2a CRISPR PAGESNo links to external sites
CITATIONS (1)