ZFIN ID: ZDB-CRISPR-171017-4
CRISPR Name: CRISPR31-tyr
Target: tyr (1)
Source:
Target Sequence:
5' - GCAGTGTGTAAAGCATCTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR31-tyr No data available
GENOMIC FEATURES CREATED WITH CRISPR31-tyrNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR31-tyr No data available
PHENOTYPE
Phenotype resulting from CRISPR31-tyr
No data available

Phenotype of all Fish created by or utilizing CRISPR31-tyr
No data available
OTHER CRISPR31-tyr CRISPR PAGESNo links to external sites
CITATIONS (1)