CRISPR

CRISPR1-dctn1b

ID
ZDB-CRISPR-170627-3
Name
CRISPR1-dctn1b
Previous Names
None
Target
Sequence
5' - GGCGAGGGCAGCGCTCCCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nl17 dctn1b
Expression
Gene expression in Wild Types + CRISPR1-dctn1b
No data available
Phenotype
Phenotype resulting from CRISPR1-dctn1b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-dctn1b
Phenotype Fish Conditions Figures
posterior lateral line nerve truncated, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
posterior lateral line nerve axon terminus has extra parts of type posterior lateral line nerve mitochondrion, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
posterior lateral line nerve retrograde axonal transport decreased occurrence, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 10 with image from Drerup et al., 2017
posterior lateral line nerve axon terminus Ab1-lamp1 labeling increased amount, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 10 with image from Drerup et al., 2017
eye decreased size, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
posterior lateral line nerve decreased length, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
posterior lateral line neuromast axon terminus swollen, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
posterior lateral line nerve anterograde axonal transport of mitochondrion decreased occurrence, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
posterior lateral line nerve retrograde axonal transport of mitochondrion decreased occurrence, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
posterior lateral line neuromast axon terminus Ab1-lamp1 labeling increased amount, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 10 with image from Drerup et al., 2017
posterior lateral line nerve axon terminus ab15-mapk labeling increased amount, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 10 with image from Drerup et al., 2017
posterior lateral line nerve axon terminus swollen, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
posterior lateral line neuromast axon terminus ab15-mapk labeling increased amount, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 10 with image from Drerup et al., 2017
posterior lateral line neuromast axon terminus has extra parts of type posterior lateral line neuromast mitochondrion, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
eye decreased diameter, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
posterior lateral line nerve decreased diameter, abnormal nl1Tg ; dctn1as309/s309 ; dctn1bnl17/nl17 standard conditions Fig. 8 with image from Drerup et al., 2017
Citations