CRISPR

CRISPR2-wnt9a

ID
ZDB-CRISPR-170222-1
Name
CRISPR2-wnt9a
Previous Names
None
Target
Sequence
5' - TGTCCATTCTGCCACTGACC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 2
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf754 wnt9a
zf758 wnt9a
Expression
Gene expression in Wild Types + CRISPR2-wnt9a
No data available
Phenotype
Phenotype resulting from CRISPR2-wnt9a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-wnt9a
Phenotype Fish Conditions Figures
interhyal cartilage chondrocyte decreased amount, abnormal wnt9azf754/zf754 standard conditions Fig. 5 with image from Ling et al., 2017
Meckel's cartilage shortened, abnormal wnt9azf754/zf754 standard conditions Fig. 2 with image from Ling et al., 2017
quadrate-anguloarticular joint morphology, abnormal wnt9azf754/zf754 standard conditions Fig. 5 with image from Ling et al., 2017
palate chondrocyte size, abnormal wnt9azf758/zf758 standard conditions Fig. 2 with image from Rochard et al., 2016
palate decreased width, abnormal wnt9azf758/zf758 standard conditions Fig. 1 with image from Rochard et al., 2016
palate increased length, abnormal wnt9azf758/zf758 standard conditions Fig. 1 with image from Rochard et al., 2016
ossification process quality, abnormal wnt9azf754/zf754; ir937Tg standard conditions Fig. 4 with image from Ling et al., 2017
endochondral bone absent, abnormal wnt9azf754/zf754; ir937Tg standard conditions Fig. 4 with image from Ling et al., 2017
Meckel's cartilage chondrocyte positional polarity, abnormal wnt9azf754/zf754; ir937Tg standard conditions Fig. 3 with image from Ling et al., 2017
head muscle decreased length, abnormal wnt9azf754/zf754; ir937Tg standard conditions Fig. 5 with image from Ling et al., 2017
chondrocyte microtubule organizing center disorganized, abnormal wnt9azf754/zf754; ir937Tg standard conditions Fig. 3 with image from Ling et al., 2017
Meckel's cartilage chondrocyte morphology, abnormal wnt9azf754/zf754; ir937Tg standard conditions Fig. 3 with image from Ling et al., 2017
ceratobranchial 5 bone absent, abnormal wnt9azf754/zf754; ir937Tg standard conditions Fig. 4 with image from Ling et al., 2017
retroarticular absent, abnormal wnt9azf754/zf754; ir937Tg standard conditions Fig. 4 with image from Ling et al., 2017
endochondral ossification disrupted, abnormal wnt9azf754/zf754; ir937Tg standard conditions Fig. 4 with image from Ling et al., 2017
palate chondrocyte size, abnormal wlszf759/zf759; wnt9azf758/zf758 standard conditions Fig. 4 with image from Rochard et al., 2016
palate decreased width, abnormal wlszf759/zf759; wnt9azf758/zf758 standard conditions Fig. 4 with image from Rochard et al., 2016
palate chondrocyte irregular spatial pattern, abnormal wlszf759/zf759; wnt9azf758/zf758 standard conditions Fig. 4 with image from Rochard et al., 2016
palate chondrocyte size, abnormal wnt9azf758/zf758; wnt5bhi2735bTg/hi2735bTg standard conditions Fig. 4 with image from Rochard et al., 2016
palate decreased width, abnormal wnt9azf758/zf758; wnt5bhi2735bTg/hi2735bTg standard conditions Fig. 4 with image from Rochard et al., 2016
Citations