CRISPR
CRISPR1-pou5f3
- ID
- ZDB-CRISPR-170117-2
- Name
- CRISPR1-pou5f3
- Previous Names
- None
- Target
- Sequence
-
5' - GGGTGAACTACTACACGCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "TGG" at the 3' end.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR1-pou5f3
No data available
Phenotype
Phenotype resulting from CRISPR1-pou5f3
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism dead, abnormal | WT + CRISPR1-pou5f3 |
Fig. 1
from Zhang et al., 2020 |
| whole organism malformed, abnormal | WT + CRISPR1-pou5f3 |
Fig. 1
from Zhang et al., 2020 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing CRISPR1-pou5f3
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| whole organism malformed, abnormal | WT + CRISPR1-pou5f3 | standard conditions |
Fig. 1
from Zhang et al., 2020 |
| whole organism dead, abnormal | WT + CRISPR1-pou5f3 | standard conditions |
Fig. 1
from Zhang et al., 2020 |
1 - 2 of 2
Citations
- Wang, X., Zhu, J., Wang, H., Deng, W., Jiao, S., Wang, Y., He, M., Zhang, F., Liu, T., Hao, Y., Ye, D., Sun, Y. (2023) Induced formation of primordial germ cells from zebrafish blastomeres by germplasm factors. Nature communications. 14:79187918
- Xie, H., Wang, X., Jin, M., Li, L., Zhu, J., Kang, Y., Chen, Z., Sun, Y., Zha, C. (2022) Cilia regulate meiotic recombination in zebrafish. Journal of molecular cell biology. 14(7)
- Zhang, F., Li, X., He, M., Ye, D., Xiong, F., Amin, G., Zhu, Z., Sun, Y. (2020) Efficient generation of zebrafish maternal-zygotic mutants through transplantation of ectopically induced and Cas9/gRNA targeted primordial germ cells. Journal of genetics and genomics = Yi chuan xue bao. 47(1):37-47
1 - 3 of 3
Show