CRISPR
CRISPR1-pou5f3
- ID
- ZDB-CRISPR-170117-2
- Name
- CRISPR1-pou5f3
- Previous Names
- None
- Target
- Sequence
-
5' - GGGTGAACTACTACACGCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "TGG" at the 3' end.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR1-pou5f3
No data available
Phenotype
Phenotype resulting from CRISPR1-pou5f3
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism dead, abnormal | WT + CRISPR1-pou5f3 |
Fig. 1
from Zhang et al., 2020 |
| whole organism malformed, abnormal | WT + CRISPR1-pou5f3 |
Fig. 1
from Zhang et al., 2020 |
Phenotype of all Fish created by or utilizing CRISPR1-pou5f3
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| whole organism malformed, abnormal | WT + CRISPR1-pou5f3 | standard conditions |
Fig. 1
from Zhang et al., 2020 |
| whole organism dead, abnormal | WT + CRISPR1-pou5f3 | standard conditions |
Fig. 1
from Zhang et al., 2020 |
Citations