CRISPR

CRISPR1-sigmar1

ID
ZDB-CRISPR-160831-3
Name
CRISPR1-sigmar1
Previous Names
None
Target
Sequence
5' - GGCCTTCTCTAAGGTGGTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
f19 sigmar1
f20 sigmar1
Expression
Gene expression in Wild Types + CRISPR1-sigmar1
No data available
Phenotype
Phenotype resulting from CRISPR1-sigmar1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sigmar1
Phenotype Fish Conditions Figures
whole organism ddit3 expression increased amount, abnormal sigmar1f19/f19 control Figure 4 with image,  Figure 5 with image from Crouzier et al., 2021
whole organism sigmar1 expression decreased amount, abnormal sigmar1f19/f19 control Figure 1 with image,  Figure 5 with image from Crouzier et al., 2021
whole organism sigmar1 expression decreased amount, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 5 with image from Crouzier et al., 2021
regulation of mitochondrial ATP synthesis coupled proton transport decreased process quality, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 7 with image from Crouzier et al., 2021
whole organism eif2s1a expression decreased amount, abnormal sigmar1f19/f19 standard conditions Figure 4 with image from Crouzier et al., 2021
whole organism xbp1 expression increased amount, abnormal sigmar1f19/f19 control Figure 5 with image from Crouzier et al., 2021
whole organism xbp1 expression increased amount, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 5 with image from Crouzier et al., 2021
retinal rod cell decreased amount, abnormal sigmar1f19/f19 standard conditions Figure 3 with image from Crouzier et al., 2021
whole organism atf4b expression decreased amount, abnormal sigmar1f19/f19 standard conditions Figure 4 with image from Crouzier et al., 2021
whole organism xbp1 expression decreased amount, abnormal sigmar1f19/f19 standard conditions Figure 4 with image from Crouzier et al., 2021
whole organism ddit3 expression increased amount, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 5 with image from Crouzier et al., 2021
cellular respiration decreased process quality, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 7 with image from Crouzier et al., 2021
whole organism hsp90b1 expression increased amount, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 5 with image from Crouzier et al., 2021
whole organism Ab6-eif2a labeling decreased amount, abnormal sigmar1f19/f19 standard conditions Figure 4 with image from Crouzier et al., 2021
whole organism sigmar1 expression decreased amount, abnormal sigmar1f19/f19 standard conditions Fig. S20 from Rennekamp et al., 2016
whole organism ern2 expression increased amount, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 5 with image from Crouzier et al., 2021
whole organism Ab11-hspa5 labeling decreased amount, abnormal sigmar1f19/f19 standard conditions Figure 4 with image from Crouzier et al., 2021
ATP biosynthetic process decreased process quality, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 7 with image from Crouzier et al., 2021
whole organism atf4b expression increased amount, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 5 with image from Crouzier et al., 2021
retinal ganglion cell decreased amount, abnormal sigmar1f19/f19 standard conditions Figure 3 with image from Crouzier et al., 2021
whole organism ern2 expression decreased amount, abnormal sigmar1f19/f19 standard conditions Figure 4 with image from Crouzier et al., 2021
whole organism atf6 expression increased amount, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 5 with image from Crouzier et al., 2021
whole organism Ab3-sigmar1 labeling decreased amount, abnormal sigmar1f19/f19 standard conditions Figure 1 with image from Crouzier et al., 2021
swimming behavior increased process quality, abnormal sigmar1f19/f19 altered light dark cycle Figure 2 with image from Crouzier et al., 2021
ATP biosynthetic process decreased process quality, abnormal sigmar1f19/f19 control Figure 6 with image,  Figure 7 with image from Crouzier et al., 2021
cellular respiration decreased process quality, abnormal sigmar1f19/f19 control Figure 6 with image,  Figure 7 with image from Crouzier et al., 2021
whole organism hspa5 expression increased amount, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 5 with image from Crouzier et al., 2021
whole organism atf4a expression increased amount, abnormal sigmar1f19/f19 chemical treatment by environment: tunicamycin Figure 5 with image from Crouzier et al., 2021
whole organism sigmar1 expression decreased amount, abnormal sigmar1f20/f20 standard conditions Fig. S20 from Rennekamp et al., 2016
Citations