Community Action Needed: Please respond to the NIH RFI
CRISPR

CRISPR2-sirt7

ID
ZDB-CRISPR-160525-17
Name
CRISPR2-sirt7
Previous Names
None
Target
Sequence
5' - ACCGCAGACACCTGCTCAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-sirt7
No data available
Phenotype
Phenotype resulting from CRISPR2-sirt7
No data available
Phenotype of all Fish created by or utilizing CRISPR2-sirt7
No data available
Citations