CRISPR

CRISPR3-pcdh15b

ID

ZDB-CRISPR-160128-89

Name

CRISPR3-pcdh15b

Previous Names

Z000116 (1)

Target

pcdh15b (2)

Sequence

5' - GGGGCTGTTGACATCGATGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

CRISPRz:Z000116 (1)

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uot14	pcdh15b
uot15	pcdh15b

Expression

Gene expression in Wild Types + CRISPR3-pcdh15b

No data available

Phenotype

Phenotype resulting from CRISPR3-pcdh15b

No data available

Phenotype of all Fish created by or utilizing CRISPR3-pcdh15b

Phenotype	Fish	Conditions	Figures
photoreceptor outer segment layer microvillus decreased length, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 3. from Miles et al., 2021
retinal rod cell has fewer parts of type retinal rod cell rod photoreceptor outer segment, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 2. from Miles et al., 2021
eye photoreceptor cell photoreceptor outer segment detached from eye photoreceptor cell cell body, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 5. from Miles et al., 2021
whole organism lethal (sensu genetics), abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 1. from Miles et al., 2021
photoreceptor outer segment layer photoreceptor outer segment malformed, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 4. , Fig. 6. from Miles et al., 2021
eye photoreceptor cell presynapse pcdh15b expression decreased amount, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 1. from Miles et al., 2021
retinal rod cell rod photoreceptor outer segment decreased length, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 2. from Miles et al., 2021
retinal cone cell has fewer parts of type retinal cone cell cone photoreceptor outer segment, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 2. from Miles et al., 2021
eye photoreceptor cell photoreceptor outer segment detached from eye photoreceptor cell photoreceptor inner segment, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 5. , Fig. 6. from Miles et al., 2021
photoreceptor outer segment layer has fewer parts of type photoreceptor outer segment layer microvillus, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 3. from Miles et al., 2021
retinal cone cell cone photoreceptor outer segment decreased length, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 2. from Miles et al., 2021
retinal rod cell photoreceptor ribbon synapse disorganized, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 8. from Miles et al., 2021
eye photoreceptor cell photoreceptor outer segment detached from eye photoreceptor cell photoreceptor inner segment, abnormal	pcdh15b^uot14/uot14	constant dark	Fig. 7. from Miles et al., 2021
photoreceptor outer segment layer photoreceptor outer segment malformed, abnormal	pcdh15b^uot14/uot14	constant dark	Fig. 7. from Miles et al., 2021
photoreceptor outer segment layer photoreceptor disc membrane malformed, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 4. from Miles et al., 2021
eye photoreceptor cell presynapse ab1-cacna1fa labeling spatial pattern, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 8. from Miles et al., 2021
eye photoreceptor cell photoreceptor inner segment membrane pcdh15b expression decreased amount, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 1. from Miles et al., 2021
eye photoreceptor cell photoreceptor outer segment detached from eye photoreceptor cell photoreceptor inner segment, exacerbated	pcdh15b^uot14/uot14	high light intensity	Fig. 7. from Miles et al., 2021
photoreceptor outer segment layer photoreceptor outer segment malformed, exacerbated	pcdh15b^uot14/uot14	high light intensity	Fig. 7. from Miles et al., 2021
retinal cone cell photoreceptor ribbon synapse disorganized, abnormal	pcdh15b^uot14/uot14	standard conditions	Fig. 8. from Miles et al., 2021
retinal rod cell has fewer parts of type retinal rod cell rod photoreceptor outer segment, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 2. from Miles et al., 2021
photoreceptor outer segment layer microvillus decreased length, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 3. from Miles et al., 2021
whole organism lethal (sensu genetics), abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 1. from Miles et al., 2021
photoreceptor outer segment layer photoreceptor outer segment malformed, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 6. from Miles et al., 2021
eye photoreceptor cell presynapse pcdh15b expression decreased amount, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 1. from Miles et al., 2021
retinal rod cell rod photoreceptor outer segment decreased length, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 2. from Miles et al., 2021
retinal cone cell has fewer parts of type retinal cone cell cone photoreceptor outer segment, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 2. from Miles et al., 2021
eye photoreceptor cell photoreceptor outer segment detached from eye photoreceptor cell photoreceptor inner segment, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 6. from Miles et al., 2021
photoreceptor outer segment layer has fewer parts of type photoreceptor outer segment layer microvillus, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 3. from Miles et al., 2021
retinal cone cell cone photoreceptor outer segment decreased length, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 2. from Miles et al., 2021
eye photoreceptor cell photoreceptor inner segment membrane pcdh15b expression decreased amount, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 1. from Miles et al., 2021
photoreceptor outer segment layer microvillus detached from photoreceptor outer segment layer photoreceptor outer segment, abnormal	pcdh15b^uot15/uot15	standard conditions	Fig. 3. from Miles et al., 2021

Citations