ZFIN ID: ZDB-CRISPR-131118-1
CRISPR Name: CRISPR1-tyr
Target: tyr (2)
Previous Names: TyrsgRNA1 (1), Z000261 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGACTGGAGGACTTCTGGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-tyr
GENOMIC FEATURES CREATED WITH CRISPR1-tyr
Genomic Feature Affected Genomic Regions    
ck112a tyr    
zf451 tyr    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-tyr No data available
PHENOTYPE
Phenotype resulting from CRISPR1-tyr
Phenotype of all Fish created by or utilizing CRISPR1-tyr
Genome Resources: CRISPRz:Z000261 (1)
CITATIONS (22)