ZFIN ID: ZDB-ALT-980203-542
Genomic Feature: m216
Synonyms:
Affected Genomic Regions: pou5f3
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Driever Lab
Location: Chr 21: 13687101 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Leu>Pro (1)
FLANKING SEQUENCE (GENOMIC)
ATAATAAGCATGGCTGATTTGATCCATAGCTTGGCTTGGAGCTTTTCTATAAACTTTAGTGAGCACCTGGAGCAAGTTAGCTGGTGAGATGACCCACCAAACCAGGGTGCAAGCCGTTTTTGAAGACATCTGGTCGGTGGAGGGATGGCATGTATAAGGCAGGGGCTCCTCCAGGATGGGCTGGTCCAGGATAGCCTTGACCTGGGAGCACAGTGCCACCCATGTGGGGTGGAGGTGGTGGACTCTGCTCGTAATACTGTGCTTCAACACACTCGTCATCAAAGGGCAAAGCTAGACGCTTTCCCTTCTGTCTACGGTTGCAGAACCATACACGCACTACCTAGAGAAAAGCACATTGTTAAAGTCAAACAGCTTCTAGAAGGTGAAAAATGCTTCACAGACTTTGAGGCGTGCTTACATCTCTCTCCAGGCCTAGATCATCGGATATGTGCGTTATCTCCAGAGTGTTGGGTTTGGGGCACTTCACGAAGTACGACTCT
A/G
GAGCAGAACGGACTGTGCCTTCCAAGCTGGTCCTTCGTTTTCTTTTTCGCGTGTCGACAAACACCCGTTCAATTTTGTACATCTGAAAGATAAATTGAAATAACATTAAGCTCAAAATTAAGCTTGTTTGACATAAATCTTTTGATAAAACCAAAGGTTAAGAGTAACAAATAAATTTTTTGCAAGTACATGGAATCATTTATGTTGTTGGCCAATCAATGCAATAAGTGGTCATTTGTTTTAGATTATAGCCTGTACAACAAATATACTTGATATGCTAGTGTGAAGATTTGTTTTCTCGTGTGAGAAAATGTAGACCACTCAACATTGTCATACACTTAAGAGTATTATACCAAAACATTTTTTCACAGTTTGTGTTTGATGTGCATAAGGGTTTCATTATGAGACATTCAACCTCCACACTAAAAATTGAATGGTGACTTTAAATGTATTTTACAACTGCTAAATGTCAAGAGTTCAGATGCAAAAACCTCTAAATG
(1)
Comment Citation
The m216 and e713 alleles show the same base change. Burgess et al., 2002
A transition from T to C replaces a highly conserved leucine with a proline at  ... Belting et al., 2001
OTHER m216 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous pou5f3m216/m216 (AB) pou5f3 Unknown
Heterozygous pou5f3m216/+ (AB) pou5f3 Unknown

CITATIONS  (12)