ZFIN ID: ZDB-ALT-191104-1
Genomic Feature: cu17
Synonyms:
Affected Genomic Regions: pax2a (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR5-pax2a
Lab Of Origin: Harris Lab
Location: Chr 13: 29773189 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 1 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TTATCAGTCACTATTGTGGTAACAAAATGTATCTATATAGACTACATAAAGCGCTTACTTTAACTACAAATTAAAAACAGTTTTTCAACGCGCTAAAGTAATAAAAAAACATTATTAACCGCCCATTAAGATTTCGATAATTGATTAACATGCGAACAAAAAGACTAAAAAAAGACAAAACATGGAGGTCAAGACTTTTTACGGGTTCATTTTTTATTTTGTTTCTTAATTAATACAGACATTAGAGCCTAACTATCTTATTGTTTATCCTCGTCCACACGTGCACACACAGGTAGTGTGTGTTTGTGCGTGCGCGCTCCCATGCGGAGAGTGTTAAAAGGGAAAAAGAAAGAGAGAGTGAGGGGAGAATGAGAAAATTAACGCTTGTGTGTGGTAGCCATGTTAACGGCACAGCATATCTTCTATATGTATGTAATGTTATGCTTTTTGTGTCTGTGTTGTTGTATCCCATATAGGGCACGGCGGTGTGAACCAGCTAG
G/-
AGGGGTGTTTGTGAATGGCAGACCCCTACCTGACGTGGTCAGGCAAAGAATCGTGGAGCTCGCACACCAAGGAGTCAGACCTTGTGACATTTCAAGACAACTACGGGTCAGCCATGGCTGTGTCAGCAAAATTCTCGGAAGGTAAGAAAAAGCACATATATTACAATTATTTCCGTTAATATACAATGCTAAAATATTATTGTTTAATGTAAATAAATCTTAAGCATGGTTGTGCTGTTATGTGTCGTAGTTTTTCTTTCTTTCTTTTTTAGTAATTTAGTAACAAAAAAGGTCTAATGTTAAGTTTACTGACCTTATTCATTGTGAAGGAGGAAGGATATGTTTTCTAGGAAACTGTTGTAGATTTTTGAATTTTTTGAAATATTTTTCAGCTATCAAAAGGATCTTATAAGGTATTCTGCACTTTAAATGTTCCTTAGAAATTATGAGATATGTGTTGGTGGCATGTATTAATCGTGGGGTGCATGGGACACACATCA
OTHER cu17 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Complex mi2001Tg ; pax2acu17/cu17 pax2a

CITATIONS  (1)