ZFIN ID: ZDB-CRISPR-180827-10
CRISPR Name: CRISPR5-pax2a
Target: pax2a (1)
Source:
Target Sequence:
5' - GGCGGTGTGAACCAGCTAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR5-pax2a No data available
GENOMIC FEATURES CREATED WITH CRISPR5-pax2aNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR5-pax2a No data available
PHENOTYPE
Phenotype resulting from CRISPR5-pax2a
Phenotype Figures
thyroid follicle aplastic/hypoplastic, abnormal Fig. 3 with image from Trubiroha et al., 2018

Phenotype of all Fish created by or utilizing CRISPR5-pax2a
Phenotype Fish Conditions Figures
thyroid follicle aplastic/hypoplastic, abnormal ulb4Tg + CRISPR5-pax2a standard conditions Fig. 3 with image from Trubiroha et al., 2018
OTHER CRISPR5-pax2a CRISPR PAGESNo links to external sites
CITATIONS (1)