Genomic Feature
tpl139Tg
- ID
- ZDB-ALT-190411-9
- Name
- tpl139Tg
- Synonyms
- None
- Affected Genomic Region
- Construct
- Type
- Allele caused by Transgenic insertion (1)
- Protocol
- embryos treated with
- Lab of Origin
- Balciunas Lab Temple
- Current Source
- Other Pages
Notes
| Comment | Citation |
|---|---|
| The LOXP site "TGAATAACTTCGTATAGCATACATTATACGAAGTTATCTG " was inserted at this ... | Burg et al., 2018 |
Variants
- Variant Type
- Transgenic Insertion
- Variant Location
- Chr 7: 30333729 - 30333730 (GRCz11) (1) Details
- Nucleotide change
- Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- Insertion in Intron 7 (1)
- Transcript Consequence
- None
- Protein Consequence
- None
- Flanking Sequence
- None
- Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None