header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190411-9
Genomic Feature: tpl139Tg
Synonyms:
Affected Genomic Regions: aldh1a2 (1)
Construct: Tg(LOXP) (1)
Type: Transgenic Insertion (1)
Protocol: embryos treated with CRISPR9-aldh1a2
Lab Of Origin: Balciunas Lab
Location: Chr 7: 30333729 - 30333730 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE (GENOMIC) No data available
NOTES
Comment Citation
The LOXP site "TGAATAACTTCGTATAGCATACATTATACGAAGTTATCTG " was inserted at this  ... Burg et al., 2018
OTHER tpl139Tg PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)