header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190411-7
Genomic Feature: tpl137
Synonyms:
Affected Genomic Regions: aldh1a2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR9-aldh1a2CRISPR10-aldh1a2
Lab Of Origin: Balciunas Lab
Location: Chr 7: 30333250 - 30333733 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE (GENOMIC)
TTTTATGACTGAACATTAGAGTTATTCAATCAAAATCATATTCTGAAGTTAGAACAGTGGTACTTTATGTTTAGTGTCTCTTTTATGTCTTTAGACTCTTTAAAAATGAAAATAAACATGACACATTTTGTTATTTTAAGCAAAAAAGAAAACCTCTAAATGACAAATAAACAAGAAAAAATAAAACACAGGTGATAATTAGGAAACATCCTCAAAAATGCCTTCTAAAATAATTGATGAATAGTTTTGGAGCCATTGAATTCTGCTTAGGCATTTGTAATACGTTTTTCTATGGTGCGTCTGCTGTTTATGCACAGATCCATGCTTATGTGTACATCTGGGTGAGATAACAGACACCTGGGAAAAGGCTGGACTGGCAGACTTTGGCATTTGACGGGTTAATGGAGCAGGCAGATTTACGGTTCTAGTGAGATGTGGTTCATTCAGCTGATTTATGGGGGGCTGTGCTTGCGGCTGCTGAAAGCATTTAAAGCACTGAC
GTGCGCCTTGGTTTGGTGGGCTACATCCAGCCACTAATGTCCAGCAGTTTAGGAAGTGAGACTCATTTACATGCAGGTATGCCTCTTCAAAACTCAAGATTTTTCTTTCTTTGGTTCAGACGCAGCTCTAAAAGCTCCCTGAAGGTCTTTGATGTGAAGTGACAGTCTGAAGCAGCACCTGTGCACAAACTGTTGCAGCGGGACAACAGGAGGCCAGCCGTAAAACAGTGTCTGAATACTTACAATCAGCATCTGCAAAAATGATGTTGGGACTCTTTCCCCCGAGCTCCAGCGTGACTCTCTTCAGATTGCTCTTTCCTGCTGCTTCTTGGATCAGCTTGCCTACCTGTGGAGACAGAGACGAGGAGCCTTAATCACAGCAGAGGAGCCTTACTAAATCTCCCTATCTGTGGGACGCTGTCATTAATAAATCGTCCCCTGCTCTTTGACTGGACAACCAGCAGCATTATCAGACCCCTGAGCT/-
TCAGCCCACATCTTAAATTTCTATTAGTGCTCGCGGAGGATGGAATGTCCCGCACGCAACAGTATCTGCTGGCTAATGGA  ...
OTHER tpl137 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)