Genomic Feature
tpl144Tg
- ID
- ZDB-ALT-190411-11
- Name
- tpl144Tg
- Synonyms
- None
- Affected Genomic Region
- Construct
- Type
- Allele caused by Transgenic insertion (1)
- Protocol
- embryos treated with
- Lab of Origin
- Balciunas Lab Temple
- Current Source
- Other Pages
Notes
Comment | Citation |
---|---|
The LOXP site "CGAATAACTTCGTATAGCATACATTATACGAAGTTATGAA " was inserted at this ... | Burg et al., 2018 |
Variants
- Variant Type
- Transgenic Insertion
- Variant Location
- Chr 23: 31555643 - 31555644 (GRCz11) (1) Details
- Nucleotide change
- Variant Notes
Effect on DNA/cDNA, transcript, protein (from publications)
- Flanking Sequence
- None
- Additional Sequence
- None
Fish
No data available
Supplemental Information
- Genotyping protocol
- None