header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181010-2
Genomic Feature: az2
Synonyms:
Affected Genomic Regions: myl7 (1)
Type: Insertion (1)
Protocol: embryos treated with CRISPR4-myl7
Lab Of Origin: Sato Lab
Location: Chr 8: 40464020 - 40464021 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 7 bp inserted (1)
FLANKING SEQUENCE (GENOMIC)
ACATGGGGAGAACTTGCAAACTCCACACAGAAATGCCAACTGACCCAGCCGAGGCTCTAACCAGCGACTTTCTTGCTATGAGGCGACTGCACTACCTACTGTGTCACCGTGTCGCCAAGCAGCAACATATTTAAGTATATATTTTAAAATAAGTATATTTATAAAATACAGTACATATAGATACATTTACATATAAAGCTGTGCAGTATATTTAACAATTTTTGTAATTGAATTTATATGCAACACTGATATAATGGACATACACTGAATACAAACCATTTCAATCATATTTAAAACATTTTATAATCACATTGGCATTCGAGCAAACCATTTAGGCTACTTGCACTTATAAGGCTTTCCATACAAAACCAATTTTTATAAAAATTTGGCACACATTAAAATGATCTGTGATGTTATGGAATTAATTATAAAGACTGACCTCCTTAAACTCCTGTATTTGTGATTGCTCAAACATGGAGAAGACATTGGAAGAGCCTCTTT
-/TCCAGAA
GAGCAGTTTTCCCCCTCTTGGCCGCGGCTTTTTTACTAGCCTGTGAGTAAAAAAAAAGAGAAGCCTTATTTGGAAACTCAATTTATAGCATTTATACACTGTAAAACCCAATAGTCAACTTTATCAAATGAAATGAGTATAGTTAACTCAAAATTGGCTGAAAATTAATTCTACTCATTTGAAAAGAGTTTTGAACTCAGTGTTGAGGGTAATGAGTTAATTAATTACCTCATTACTTCAACTTAAATGGAGTAAGTTCACAGTACTCATATTGATTCTTTTTTTTTAACTCAAATGGTTTGTAGCAATCGGTTTCCTCAAACGGTGTGAGCTGCCTCATCTTATTGGGTTTTACAGTACTCAGTTGGTTGAGTTCTCTTCATTTACTGGGTTTTACTGTGCTCAAATTGCTTCTTTTACTCAAATAGATTAAGTTCACAGTACTCATTTAGATTAGTTTTTGAACTTCAGATGGCTTGTTACAATCGGTTTTCTCAAATG
OTHER az2 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous myl7az2/az2 myl7 Unknown

CITATIONS  (1)