header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180419-1
CRISPR Name: CRISPR4-myl7
Target: myl7 (1)
Source:
Target Sequence:
5' - AGGGGGAAAACTGCTCAAAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR4-myl7 No data available
GENOMIC FEATURES CREATED WITH CRISPR4-myl7
Genomic Feature Affected Genomic Regions    
az1 myl7    
az2 myl7    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR4-myl7 No data available
PHENOTYPE
Phenotype resulting from CRISPR4-myl7
No data available

Phenotype of all Fish created by or utilizing CRISPR4-myl7
Genome Resources:
CITATIONS (1)