header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181002-141
Genomic Feature: sa45210
Synonyms:
Affected Genomic Regions: dab2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 32330894 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Missense, Splice Site (1)
FLANKING SEQUENCE
CCAACTCTGAGTTCAGATCCCTTCAGCGACGATCCCTTTTCTCCCTTGAA
T/A
GATCAATCAGATTCTGTGTTTTCCTCCAATAACGAGTCAGATTTTTCTAG
(1)
OTHER sa45210 PAGES
ZMP:sa45210 (1)
GENOTYPESNo data available

CITATIONS  (1)