ZFIN ID: ZDB-ALT-161003-17876
Genomic Feature: sa5952
Synonyms:
Affected Genomic Regions: si:dkey-177p2.6 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 20: 26958763 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AATCTTTTTAAAGATATAAAGATGCTCCCAAACCTTGCAAAATACAGAACAATGTTTGTTTTCAAACAAGTTTTTAAAAACAAATGTTCTTCCGTTAATTGTTCATTGTCACTGACCCACTTATTGGATTTGTTTTGTACATTTCAGAGATATAGAGGCTTGTGCAATGTCGCAAATAAACTTTAGTGTTGCTATATACACTGTCTGTGCCTTTTATTTGTTTTTGGGAGCAGTATAACGTTGGATAAGGCTTAAAGTTAAAACCACTTTCATGCAACATGATGTTTTATTTCACCTCTAGTTAAAACAGTGAGGGAAATATTTCTGTCCTGTGTTTTTGAACTTTTTTTTGTTTGTTTGTTTGTCTTCCTCTATAGATATCTGTTGGGCCGGGGGGTAAAGCGTAAGCTGAGCACATGTGAAGACCCAGCCCAGGACTTGCCATATCCTCAGCAGAGGCAGCTGGTGCTGGACCTGTGTCTAGACAAACTACAAAGCTG
C/A
CAGCGGCGAGCGGAACCCAGCCTGCACCGTTCGGTCCTCCTGGCCAACACTCTCCGCCAGATTCAGCAGGAGATGAGACAGGAGGGGGAAACCTGTTTGCCACCAGCCGTACTCGGGCCCTCTCTTCCTCACATCCAGACCCCACGCCACGTCCCAGAGCTGCCACCCGTGCCCTTAGACTGTCCTGCACCTCTAACCGGTGCACTGTCCCCTTCATTTCCCCTTATGACAGCTGATGAAGAGGAGATCCAGTTGGGTGGCACTGAAAATGAGACTCTTCTGCCATCCCTCGCTGGTGAAGACAACACAAAGTCGTCAGATTTGCTTTTTGGCTCATTTGAGATTACAAACTCCACCAGCTACTTAACAGACTTGGCATTAGATGACATCTTTGAGGACATCGACACGTCCATGTATGACTCCTCTGACATTTCTGTTCTCGCGGTTCCTGCACAGAGAAGCGGCGGGGTAGACGATGGCCTCAAGAGCCTTTCCAGCTG
(1)
OTHER sa5952 PAGES
ZMP:sa5952 (1)
GENOTYPES No data available

CITATIONS  (1)