ZFIN ID: ZDB-ALT-161003-13804
Genomic Feature: sa29528
Synonyms:
Affected Genomic Regions: rx3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 10757122 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
TTTATGCACGTGTGTTTAGTACATTTTAGATTTCAGTGTTTAAAAAGTAGGTTAAATTTTTTTTTTTTTCAAAATTAAACAATGAAAAATGAACAGAAAATCTTAAGTATGCTATTTTAATTGAAAAGGTAATAAGGCATATAAATATGTGAAATATGGTAATCAAAGTTGTCAAAAATATGTCAGAATTATAAATATGAACATGTTGCACTTTCTCACATATTTCTCACTGTTGGTTTTTTTTTTTTTTTTCTCTCTCTCTCTTTATGCAGGAGTTTGTAGGTCGACTGTAATGGTCAGCCCAGATCTGCCAGACGCGGATGGTGGTAAATTGTCGGATGATGAAAACCCGAAGAAAAAGCACCGGCGGAACCGAACCACGTTCACCACCTTCCAGCTCCACGAGCTCGAGCGCGCCTTCGAGAAGTCGCACTATCCGGATGTCTACAGCAGAGAGGAGCTCGCGCTGAAGGTCAACCTGCCCGAAGTCCGAGTACAGG
T/G
GAGAGACACTTTATTCTGTTCAAACTAATACAGCAATAATAAATATTGTATATATGTATTTATTTGTTTAAAGATGGAGAAGTATAGGCTACTAAAATACAAATTCCACTTCTAACTTTTATGTCACTGAAAAAAATGTTTCATTGGATTTGCTGAATTATTTTAAGGTAAATTGTTGCAAACAATTTATATGGGCTAAAATTAAACAAGTTAAGTTGAAAATTACTAAATTTTTAACTCGTTTGTTTAATTCAGCCCATATAAACTGTTTGCAACTTAAACAAATAAATCCAATTAATAATTTTATTTAGTGTTGGCTATATGAAGTTTACTTGCAAAAAAACGGTTACTCTGTACAGATTTTTATAAATCCTGTTTTATTGTAGTACATTGAAGATATCATTATGAAAAAGAATTGTAAAAAATGATTGATGATAGTATAAAAACATTAATAAAACTAGTATATATTCTTTATTATGCGATTGTTAAATGTAAAGTAT
(1)
OTHER sa29528 PAGES
ZMP:sa29528 (1)
GENOTYPES No data available

CITATIONS  (1)