Genomic Feature

fb102

ID
ZDB-ALT-160323-2
Name
fb102
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Langenau Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 8: 13395243 - 13395252 (GRCz11) (1) Details
Nucleotide change
CCAAGCCTGC/ACTCTCCAGGACACAACA
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
18 bp inserted / 10 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Pro>Stop at position 369 (1)
Sequences
Flanking Sequence
TTTTCTCTCTGCTTACAGGAATGGCAGACATTCTGTGACTTCCCCCAGATCATTGACATTAGCATTAAGCGTCTCTGTCAAGAGCAGATGCCTCTGGAAGGAAGGGTGGTCACACTCACGCGCCAGGATGACCAGTGCATGGAAGTGGCATTTATATTCATACATTCAAGAATGAACACATAAACTAAACTCATTATAATAGAAATTATGCTTTGGTTCTGATACTAACAGCAAAGAGTACTTTCCTTCCTAATGAGTTTATATCTCAACCATTTTTATTTTATAATGTGTGAAAGTATAATAAATTGAAGCTTGTTTTTTCCTCTTAATTCTACTTTGCATATCAGTTTGTTTTACTTTGTGCCTTTTCTGACTCTTTCTGTTAACAGGAGGCTGAGTTTCAAACCCTGACAGACGCCCTTTCCTTTGTATCTCTGGTTGATGGATATTTTAGACTGACCACAGATTCAACTCACTATTTCTGCGCAGAAGTGGCCCCA
CCAAGCCTGC/ACTCTCCAGGACACAACA TGGAGGACATACAGAATTACTGCCACGGCCCGATCACGTATTACACAATTTCACATTTAACTGTATTATCAAATTAGGAAATGATTTGGGACACATCCTAGTCCATTCCTGGTTTAGTACTTAGTAATAGTAGGCACTAATCAGGAGGTTCTCAATTCTCAAGGTGCTCTCTAAATATCCCCTAAAATGCTCTCATATGCAAAAGCAATATATGTACACAACCTAACCTAAGTCTTGTCATTGATGCCAGTTGTAAAAGCCACAAATAATAACTTGACTTCTAGTTGATCATTTGGAAAAGTGTCAGAAGGCAGATTTTTTCGATGGATCATCTGTTAAACTGCATCCCAATCATCACAAATACTGCAGAAGACCTATTGGAACCCACATGGACCCAAGATTTACACAGAAATCAGTCAAGTTTGTTGAAGGAAAAATCATGGTTTGGGGTTACATTCAGTATGAGGGTGTGTGAGAGATCTGCTGAGTGGATGTCAACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations