header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-120411-25
Genomic Feature: sa1148
Synonyms:
Affected Genomic Regions: frem1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 7: 69676749 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CAGCTTCCAGCCTCCCAACTCCAGCGCCACACATCGCAGGAACTACGAGG
T/C
GAAACACGAATGCTTTAACATACTGTTTGTTTTTTTTATTGTATTTTTTT
(1)
OTHER sa1148 PAGES
ZMP:sa1148 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous frem1asa1148/sa1148 (TL) frem1a ♀+/- ♂+/-

CITATIONS  (3)