ZFIN ID: ZDB-ALT-120411-101
Genomic Feature: sa1329
Synonyms:
Affected Genomic Regions: pou5f3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 13690432 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
GCCGTAATTTGGGACAGTCCAGGCCAGAAATTAGGGTTCCATGGCGTGTAGTAGTTCACCCCGGTGGGGACGGAAGATGTTCCAGCGGTGAGGTGATATTGTGACGGCGGCTTGTTTTCTTCATTCCCGTATTCTTCAACATCTTTCTCGGTTTTGACCTCAGATGGCATCTTAATTTGCTCTCTAGTCTCGCCGATAGGAGGGCTGATGTTCGCCGGCTGAGTGGCGGCCGTCGCTCCTGCAACCTGCCCAGTGAACTCGGGGGCCGCAAACGGGTACCAGTGTTTGGGCTGCGTAAAGTCGCCACCTTGCAAATCGTTCGTTTTAAAATCGCCTGAAAATGGAAAGAAGGTCTGGGCTGTCGCGGGGGTGATTCCGTTGAAATGGGCCTTGTTAAAAATCAGACTTGGATCCTGAAGCATACCGTGCGCAAACTGCAAGGACGCTCCGCCAAGTCCATCCAGGCCCGCGGCTTGAGGATACATGGCCCTGTTGACCTC
A/T
TAGGGTCTGCAGTCTGCTGCTGTTGGGCTCTGCGCTCTCTCCGTCATCTTTCCGCTAAAAAGGTTGTTGAGATTTCAAACAAGAAAGCGTAAAGACTGCTGGTTTGATAATCAATAAACGTCGATCAGTTGCTCCATCCCAGGATGATCCAAACAGACTAAACTCAGATTGCGCGTCTCAGTATCAGCCTGTGTGGAAATGTGCGCAGTCCTTGTGTGGCGGCCATCAATCAGAATGGGCCAATAATTCACCACCTCCAACTCTTCCCAATCTCAGCTCTGATCCTGGCCCACACAGGTTTTGCTAATCAATCGGAGTTGGAGGCAGGGGTCTGAACCAACTTCTCTCCCATTGGCCACCCGAGACAATAAGCTACAGCTGACTGTGAATTTGTGAATGAACTTGGTTTTCTCATTGGGCGAGGACATGTTTGGGAACGCGAGGTGTATCTGTATAGATTTGCATCTTATAAAAGTCCAAATAAAAATAGATTAACCTCA
(1)
OTHER sa1329 PAGES
ZMP:sa1329 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous pou5f3sa1329/sa1329 (TL) pou5f3 ♀+/- ♂+/-

CITATIONS  (3)