header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-100506-22
Genomic Feature: sa54
Synonyms: sa0054 (1)
Affected Genomic Regions: sox17 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 7: 58774373 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>G (1)
Transcript Consequence: Missense (1)
FLANKING SEQUENCE
AAATTATTATCAAATTTACATTGTGTCCTCTATTGTTCTGTTTATAGGTA
A/G
GTCATGGAAAGCTTTACCAATGGTGGACAAACGTCCATTCGTTGAGGAGG
(1)
OTHER sa54 PAGES
ZMP:sa54 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Heterozygous sox17sa54/+ (AB) sox17 Unknown
Unknown sox17sa54 sox17 Unknown

CITATIONS  (5)