header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-100412-1
Genomic Feature: hu3625
Synonyms:
Affected Genomic Regions: otx2b (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 17: 44246366 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GTTGTTGCTGCTGTTGGCGACACTTTGCCCTTCGGTTTTTGAACCAAACC
T/G
GATGTGTTGAAAAAAAGGGGTTTTTATTATTTACGACGTGAACTAACGGC
(1)
OTHER hu3625 PAGES
ZMP:hu3625 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous otx2bhu3625/hu3625 (TL) otx2b ♀+/- ♂+/-
Heterozygous otx2bhu3625/+ (AB) otx2b Unknown
Unknown otx2bhu3625 otx2b Unknown

CITATIONS  (6)