ZFIN ID: ZDB-ALT-040513-2
Genomic Feature: w29
Synonyms:
Affected Genomic Regions: rx3
Type: Point Mutation (2)
Protocol: ENU 
Lab Of Origin: David Raible Lab
Location: Chr 21: 10757057 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A in Exon 2 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Tyr>Stop at position 133 (1)
FLANKING SEQUENCE (GENOMIC)
CTTTTTTTATTTAGCTCTTACAATTTAAGTAATTAGTATAATAGGCTATATTTATATATCTACGTTTTATGCACGTGTGTTTAGTACATTTTAGATTTCAGTGTTTAAAAAGTAGGTTAAATTTTTTTTTTTTTCAAAATTAAACAATGAAAAATGAACAGAAAATCTTAAGTATGCTATTTTAATTGAAAAGGTAATAAGGCATATAAATATGTGAAATATGGTAATCAAAGTTGTCAAAAATATGTCAGAATTATAAATATGAACATGTTGCACTTTCTCACATATTTCTCACTGTTGGTTTTTTTTTTTTTTTTCTCTCTCTCTCTTTATGCAGGAGTTTGTAGGTCGACTGTAATGGTCAGCCCAGATCTGCCAGACGCGGATGGTGGTAAATTGTCGGATGATGAAAACCCGAAGAAAAAGCACCGGCGGAACCGAACCACGTTCACCACCTTCCAGCTCCACGAGCTCGAGCGCGCCTTCGAGAAGTCGCACTA
T/A
CCGGATGTCTACAGCAGAGAGGAGCTCGCGCTGAAGGTCAACCTGCCCGAAGTCCGAGTACAGGTGAGAGACACTTTATTCTGTTCAAACTAATACAGCAATAATAAATATTGTATATATGTATTTATTTGTTTAAAGATGGAGAAGTATAGGCTACTAAAATACAAATTCCACTTCTAACTTTTATGTCACTGAAAAAAATGTTTCATTGGATTTGCTGAATTATTTTAAGGTAAATTGTTGCAAACAATTTATATGGGCTAAAATTAAACAAGTTAAGTTGAAAATTACTAAATTTTTAACTCGTTTGTTTAATTCAGCCCATATAAACTGTTTGCAACTTAAACAAATAAATCCAATTAATAATTTTATTTAGTGTTGGCTATATGAAGTTTACTTGCAAAAAAACGGTTACTCTGTACAGATTTTTATAAATCCTGTTTTATTGTAGTACATTGAAGATATCATTATGAAAAAGAATTGTAAAAAATGATTGATGA
(1)
OTHER w29 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous rx3w29/w29 rx3 ♀+/- ♂+/-
rx3w29/w29 (AB) rx3 Unknown
Heterozygous rx3w29/+ (AB) rx3 Unknown

CITATIONS  (10)