Genomic Feature
m21
- ID
- ZDB-ALT-030627-2
- Name
- m21
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one point mutation (1)
- Protocol
- ENU
- Lab of Origin
- Driever Lab
- Current Source
- Other Pages
Notes
No data available
Variants
- Variant Type
- Point Mutation
- Variant Location
- Chr 5: 72266412 (GRCz11) (1) Details
- Nucleotide change
- G/A
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- C>T at position 1356 (1)
- Transcript Consequence
- Premature Stop (1)
- Protein Consequence
- Polypeptide Truncation: Gln>Stop at position 316 (1)
- Flanking Sequence
-
ATCTGCAGTTCACTGAACGGCCACCAGTGGCGCTAATAACAAGATCTTTGCGGTTACGTAAAAAGGCCAGTTTAGTTCAATCTACAACTTTTAAAAAATACATATACTTATTTTTCAACATTTACAATTTAATAATTATCATAAATATTGCAGATTTTTTCCGAACCATTTTCATTAACCAACGCAATCTCACTGCAGTCCGTAACTTAATCTGATGATCTCATTCGTACATATTAGTGTGGTTTGCTTATCCTTCAATGAGGATCAGGTATCAGTGTGTGGTTTAGAGGCACACCTATTTTTAAAATCTTATGCCTTCATATAAATTAAATAGTTTTATTTAGAACGAATTAGCCACTCTTCTGACGATAGGTTAGATAGTTACATTACCTCGTGAGATCGGCTGTCAGTAACAGTAATACATCTAACAAACGTAATGCTGATTACAGCTGGCCGGCTTAAGCTGTACACACCTTTCCTCTTGATGCAGTGGTAGTCCT
G/A TGTGTGTTCGTGGTAGGAGCTGGACTGAGGCAGCAGGTCCTGAGATGTGCTGGAAACGCCGTTCTCACAGGAATACTGTGAGCTTATGGCTCCAGACGCTGACAGACCCTGGACGTCTCCGCTGAACGGGCTCTGACTGCTTCCCACACGCTGCCGCACAGTGCTGCGAGGAACCACCGGGTACTCCTTAGTGCTAGAGATGACAGAAATGACATTTATAGTGTTTCATGGCACACATGCAGTATGTGGACACCAATACTCTGACTTTAATATGATTAAAGTGGACATATATTGCAGAGATCTGTATTATAAGGACTTTAACCCCAGTTGTGTGTGTCAGCAGTGTGTCTCCAGCAGCCTCTGATGATCAACATGAATTAACTGTGTTGTGTTAATCAGACTTGATGCAGAAACTCTGTGATTGACATTCTCCCTTCGTATGTGTAATCAGTGGGGGAAAGCCCCGCCCACTAGTGCCCATCTCTCCATCTCATTAGCAT - Additional Sequence
- None
Fish
| Fish | Genomic Feature Zygosity | Parental Zygosity | Affected Genomic Regions | Phenotype | Gene Expression |
|---|---|---|---|---|---|
| tbx5am21/m21 | Homozygous | Unknown | 8 figures  from 5 publications | 9 figures from 5 publications | |
| tbx5am21/m21 | Homozygous | ♀+/- ♂+/- | 8 figures from 6 publications | 10 figures from 5 publications | |
| tbx5am21/+ | Heterozygous | Unknown | 3 figures from Camarata et al., 2010 | 3 figures from Camarata et al., 2010 | |
| tbx5am21/m21; f2Tg | Complex | Fig. 6 from Parrie et al., 2013 | |||
| tbx5am21/m21; s883Tg | Complex | Fig. 4 from Parrie et al., 2013 | |||
| tbx5am21/m21; sd12Tg/sd12Tg | Complex | Fig. 10 from Auman et al., 2023 | Fig. 10 from Auman et al., 2023 | ||
| tbx5am21/+ + MO4-pdlim7 | Complex | Fig. 9 from Camarata et al., 2010 | Fig. 9 from Camarata et al., 2010 | ||
| tbx5am21/m21; f2Tg + MO1-tbx5b | Complex | Fig. 6 from Parrie et al., 2013 | |||
| tbx5am21/m21; s883Tg + MO1-tbx5b | Complex | Fig. 4 from Parrie et al., 2013 |
1 - 9 of 9
Show
Supplemental Information
- Genotyping protocol
- None
- Auman, H.J., Fernandes, I.H., Berríos-Otero, C.A., Colombo, S., Yelon, D. (2023) Zebrafish smarcc1a mutants reveal requirements for BAF chromatin remodeling complexes in distinguishing the atrioventricular canal from the cardiac chambers. Developmental Dynamics : an official publication of the American Association of Anatomists. 253(1):157-172
- Tessadori, F., Tsingos, E., Colizzi, E.S., Kruse, F., van den Brink, S.C., van den Boogaard, M., Christoffels, V.M., Merks, R.M., Bakkers, J. (2021) Twisting of the zebrafish heart tube during cardiac looping is a tbx5-dependent and tissue-intrinsic process. eLIFE. 10:
- Pawlak, M., Kedzierska, K.Z., Migdal, M., Nahia, K.A., Ramilowski, J.A., Bugajski, L., Hashimoto, K., Marconi, A., Piwocka, K., Carninci, P., Winata, C.L. (2019) Dynamics of cardiomyocyte transcriptome and chromatin landscape demarcates key events of heart development. Genome research. 29(3):506-519
- Steimle, J.D., Rankin, S.A., Slagle, C.E., Bekeny, J., Rydeen, A.B., Chan, S.S., Kweon, J., Yang, X.H., Ikegami, K., Nadadur, R.D., Rowton, M., Hoffmann, A.D., Lazarevic, S., Thomas, W., Boyle Anderson, E.A.T., Horb, M.E., Luna-Zurita, L., Ho, R.K., Kyba, M., Jensen, B., Zorn, A.M., Conlon, F.L., Moskowitz, I.P. (2018) Evolutionarily conserved Tbx5-Wnt2/2b pathway orchestrates cardiopulmonary development.. Proceedings of the National Academy of Sciences of the United States of America. 115(45):E10615-E10624
- Adachi, N., Robinson, M., Goolsbee, A., Shubin, N.H. (2016) Regulatory evolution of Tbx5 and the origin of paired appendages. Proceedings of the National Academy of Sciences of the United States of America. 113(36):10115-20
- Pi-Roig, A., Martin-Blanco, E., Minguillón, C. (2014) Distinct tissue-specific requirements for the zebrafish tbx5 genes during heart, retina and pectoral fin development. Open Biology. 4:140014
- Parrie, L.E., Renfrew, E.M., Vander Wal, A., Mueller, R.L., and Garrity, D.M. (2013) Zebrafish tbx5 paralogs demonstrate independent essential requirements in cardiac and pectoral fin development. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(5):485-502
- Camarata, T., Krcmery, J., Snyder, D., Park, S., Topczewski, J., and Simon, H.G. (2010) Pdlim7 (LMP4) regulation of Tbx5 specifies zebrafish heart atrio-ventricular boundary and valve formation. Developmental Biology. 337(2):233-245
- Liu, J., and Stainier, D.Y. (2010) Tbx5 and Bmp Signaling Are Essential for Proepicardium Specification in Zebrafish. Circulation research. 106(12):1818-1828
- Rothschild, S.C., Easley, C.A. 4th, Francescatto, L., Lister, J.A., Garrity, D.M., and Tombes, R.M. (2009) Tbx5-mediated expression of Ca(2+)/calmodulin-dependent protein kinase II is necessary for zebrafish cardiac and pectoral fin morphogenesis. Developmental Biology. 330(1):175-184
1 - 10 of 15
Show